ID: 941272638

View in Genome Browser
Species Human (GRCh38)
Location 2:163449863-163449885
Sequence TTCACAACCGAATTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941272638_941272641 23 Left 941272638 2:163449863-163449885 CCAGCACCAAATTCGGTTGTGAA No data
Right 941272641 2:163449909-163449931 ATAGAAATATCCCATGTTTTTGG No data
941272638_941272640 -1 Left 941272638 2:163449863-163449885 CCAGCACCAAATTCGGTTGTGAA No data
Right 941272640 2:163449885-163449907 ATAGTGTGTTGTAAAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941272638 Original CRISPR TTCACAACCGAATTTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr