ID: 941273244

View in Genome Browser
Species Human (GRCh38)
Location 2:163457150-163457172
Sequence CTGAGGGTAAAGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941273244_941273248 15 Left 941273244 2:163457150-163457172 CCCTCTTCTCTCTTTACCCTCAG No data
Right 941273248 2:163457188-163457210 CACTTCTGTTAATAGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941273244 Original CRISPR CTGAGGGTAAAGAGAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr