ID: 941275334

View in Genome Browser
Species Human (GRCh38)
Location 2:163483914-163483936
Sequence TAGTTCATCTGCAAGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941275331_941275334 27 Left 941275331 2:163483864-163483886 CCTGGGTGAGCTAGAATCATACT No data
Right 941275334 2:163483914-163483936 TAGTTCATCTGCAAGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941275334 Original CRISPR TAGTTCATCTGCAAGGCTCA TGG Intergenic
No off target data available for this crispr