ID: 941279548

View in Genome Browser
Species Human (GRCh38)
Location 2:163533125-163533147
Sequence GCCAGTACTTTGATGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941279548_941279551 9 Left 941279548 2:163533125-163533147 CCAAATGCCATCAAAGTACTGGC No data
Right 941279551 2:163533157-163533179 CAGTGTAGGATCCATGTGAAAGG No data
941279548_941279550 -5 Left 941279548 2:163533125-163533147 CCAAATGCCATCAAAGTACTGGC No data
Right 941279550 2:163533143-163533165 CTGGCTGCAATTCACAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941279548 Original CRISPR GCCAGTACTTTGATGGCATT TGG (reversed) Intergenic
No off target data available for this crispr