ID: 941280231

View in Genome Browser
Species Human (GRCh38)
Location 2:163540726-163540748
Sequence CAAAACAATTAGCTGGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941280229_941280231 -3 Left 941280229 2:163540706-163540728 CCTTGTCTCTACAAATAATACAA 0: 41
1: 3747
2: 75275
3: 176730
4: 205237
Right 941280231 2:163540726-163540748 CAAAACAATTAGCTGGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941280231 Original CRISPR CAAAACAATTAGCTGGAGTG TGG Intergenic
No off target data available for this crispr