ID: 941282337

View in Genome Browser
Species Human (GRCh38)
Location 2:163568639-163568661
Sequence TAGCTCTAAAGGGACTGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941282337_941282341 1 Left 941282337 2:163568639-163568661 CCTAAGCAGTCCCTTTAGAGCTA No data
Right 941282341 2:163568663-163568685 AATGCTGCTGATGTTGGTATAGG No data
941282337_941282340 -5 Left 941282337 2:163568639-163568661 CCTAAGCAGTCCCTTTAGAGCTA No data
Right 941282340 2:163568657-163568679 AGCTACAATGCTGCTGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941282337 Original CRISPR TAGCTCTAAAGGGACTGCTT AGG (reversed) Intergenic
No off target data available for this crispr