ID: 941282340

View in Genome Browser
Species Human (GRCh38)
Location 2:163568657-163568679
Sequence AGCTACAATGCTGCTGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941282337_941282340 -5 Left 941282337 2:163568639-163568661 CCTAAGCAGTCCCTTTAGAGCTA No data
Right 941282340 2:163568657-163568679 AGCTACAATGCTGCTGATGTTGG No data
941282336_941282340 3 Left 941282336 2:163568631-163568653 CCTAGTTTCCTAAGCAGTCCCTT No data
Right 941282340 2:163568657-163568679 AGCTACAATGCTGCTGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941282340 Original CRISPR AGCTACAATGCTGCTGATGT TGG Intergenic
No off target data available for this crispr