ID: 941282341

View in Genome Browser
Species Human (GRCh38)
Location 2:163568663-163568685
Sequence AATGCTGCTGATGTTGGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941282336_941282341 9 Left 941282336 2:163568631-163568653 CCTAGTTTCCTAAGCAGTCCCTT No data
Right 941282341 2:163568663-163568685 AATGCTGCTGATGTTGGTATAGG No data
941282339_941282341 -10 Left 941282339 2:163568650-163568672 CCTTTAGAGCTACAATGCTGCTG No data
Right 941282341 2:163568663-163568685 AATGCTGCTGATGTTGGTATAGG No data
941282337_941282341 1 Left 941282337 2:163568639-163568661 CCTAAGCAGTCCCTTTAGAGCTA No data
Right 941282341 2:163568663-163568685 AATGCTGCTGATGTTGGTATAGG No data
941282338_941282341 -9 Left 941282338 2:163568649-163568671 CCCTTTAGAGCTACAATGCTGCT No data
Right 941282341 2:163568663-163568685 AATGCTGCTGATGTTGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941282341 Original CRISPR AATGCTGCTGATGTTGGTAT AGG Intergenic
No off target data available for this crispr