ID: 941286024

View in Genome Browser
Species Human (GRCh38)
Location 2:163613145-163613167
Sequence AGTTAGTTACAGAAGAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941286017_941286024 23 Left 941286017 2:163613099-163613121 CCAGGGCCCAAAGCGATTTATAA No data
Right 941286024 2:163613145-163613167 AGTTAGTTACAGAAGAGGACTGG No data
941286018_941286024 17 Left 941286018 2:163613105-163613127 CCCAAAGCGATTTATAATGTACC No data
Right 941286024 2:163613145-163613167 AGTTAGTTACAGAAGAGGACTGG No data
941286022_941286024 -5 Left 941286022 2:163613127-163613149 CCTCGAGGTCTCACATACAGTTA No data
Right 941286024 2:163613145-163613167 AGTTAGTTACAGAAGAGGACTGG No data
941286019_941286024 16 Left 941286019 2:163613106-163613128 CCAAAGCGATTTATAATGTACCC No data
Right 941286024 2:163613145-163613167 AGTTAGTTACAGAAGAGGACTGG No data
941286021_941286024 -4 Left 941286021 2:163613126-163613148 CCCTCGAGGTCTCACATACAGTT No data
Right 941286024 2:163613145-163613167 AGTTAGTTACAGAAGAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941286024 Original CRISPR AGTTAGTTACAGAAGAGGAC TGG Intronic
No off target data available for this crispr