ID: 941292497

View in Genome Browser
Species Human (GRCh38)
Location 2:163694622-163694644
Sequence TCCCAGTGACTTTACTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941292497_941292499 21 Left 941292497 2:163694622-163694644 CCAGGAAAGTAAAGTCACTGGGA No data
Right 941292499 2:163694666-163694688 TACATTAAGAGCAAAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941292497 Original CRISPR TCCCAGTGACTTTACTTTCC TGG (reversed) Intronic