ID: 941294399

View in Genome Browser
Species Human (GRCh38)
Location 2:163718008-163718030
Sequence AGATGCACAGATTGTCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941294399_941294407 13 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294407 2:163718044-163718066 GTTGGAAAGTACAGGGGGGAGGG No data
941294399_941294403 7 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294403 2:163718038-163718060 GATCATGTTGGAAAGTACAGGGG No data
941294399_941294405 9 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294405 2:163718040-163718062 TCATGTTGGAAAGTACAGGGGGG No data
941294399_941294409 15 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294409 2:163718046-163718068 TGGAAAGTACAGGGGGGAGGGGG No data
941294399_941294408 14 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294408 2:163718045-163718067 TTGGAAAGTACAGGGGGGAGGGG No data
941294399_941294411 30 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294411 2:163718061-163718083 GGAGGGGGGAGAGTGTGTCAAGG No data
941294399_941294406 12 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294406 2:163718043-163718065 TGTTGGAAAGTACAGGGGGGAGG No data
941294399_941294400 -5 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294400 2:163718026-163718048 CATCTGAATGTTGATCATGTTGG No data
941294399_941294410 16 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294410 2:163718047-163718069 GGAAAGTACAGGGGGGAGGGGGG No data
941294399_941294402 6 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294402 2:163718037-163718059 TGATCATGTTGGAAAGTACAGGG No data
941294399_941294401 5 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294401 2:163718036-163718058 TTGATCATGTTGGAAAGTACAGG No data
941294399_941294404 8 Left 941294399 2:163718008-163718030 CCAAGCAGACAATCTGTGCATCT No data
Right 941294404 2:163718039-163718061 ATCATGTTGGAAAGTACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941294399 Original CRISPR AGATGCACAGATTGTCTGCT TGG (reversed) Intronic
No off target data available for this crispr