ID: 941295837

View in Genome Browser
Species Human (GRCh38)
Location 2:163736838-163736860
Sequence ATTCACAGGGAGGCGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941295837_941295846 0 Left 941295837 2:163736838-163736860 CCCTCCCCCGCCTCCCTGTGAAT 0: 1
1: 0
2: 1
3: 28
4: 344
Right 941295846 2:163736861-163736883 AAATAAAATCCTAAGTGTCTAGG 0: 1
1: 0
2: 2
3: 26
4: 421
941295837_941295849 27 Left 941295837 2:163736838-163736860 CCCTCCCCCGCCTCCCTGTGAAT 0: 1
1: 0
2: 1
3: 28
4: 344
Right 941295849 2:163736888-163736910 CGGTCCCCTCTCGCGCTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180
941295837_941295847 7 Left 941295837 2:163736838-163736860 CCCTCCCCCGCCTCCCTGTGAAT 0: 1
1: 0
2: 1
3: 28
4: 344
Right 941295847 2:163736868-163736890 ATCCTAAGTGTCTAGGTGTGCGG 0: 1
1: 0
2: 2
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941295837 Original CRISPR ATTCACAGGGAGGCGGGGGA GGG (reversed) Intergenic
900365293 1:2309709-2309731 ACCCACAGGGAGGAGGGGGTGGG - Exonic
900365313 1:2309747-2309769 ACCCACAGGGAGGAGGGGGTGGG - Exonic
900365334 1:2309786-2309808 ACCCACAGGGAGGAGGGGGTGGG - Exonic
900365357 1:2309827-2309849 ACCCACAGGGAGGAGGGGGTGGG - Exonic
900465253 1:2822231-2822253 AGTCAAGGGGAGGCTGGGGAGGG + Intergenic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
901000174 1:6145089-6145111 ATTCTCAGGGAGGCCTGGGGAGG + Intronic
901804563 1:11729965-11729987 ATTCCAAGGGAGGCGTTGGAGGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902388151 1:16087946-16087968 AGGCACAGGGAGGAGGGAGAGGG - Intergenic
902633250 1:17718368-17718390 ATTCACAGGCAGGTGGCAGAAGG + Intergenic
902742132 1:18446007-18446029 AGTCTTAGGGAGGCAGGGGATGG - Intergenic
902820751 1:18941827-18941849 ATCCCCAGGGAGGCGGGGACAGG + Intronic
902823107 1:18955633-18955655 CGTCCCAGGGCGGCGGGGGAGGG + Intronic
903253290 1:22072693-22072715 AGTGACAGGGTGGCGGTGGAAGG - Intronic
904356862 1:29946031-29946053 ATTCACTGGGAGGAGTTGGAAGG - Intergenic
904486125 1:30825426-30825448 ATTCTCAGGCAGTTGGGGGATGG + Intergenic
904766258 1:32850330-32850352 TTTCAGTGGGAGGCAGGGGAGGG - Intronic
904901713 1:33862757-33862779 GCTCACAGGGAGGAAGGGGATGG + Intronic
905252025 1:36655677-36655699 AATCAAAGGGAGGCAGCGGAGGG - Intergenic
905318899 1:37101667-37101689 CTTCACAGGGAGGCAGAGGCAGG - Intergenic
905467630 1:38167263-38167285 ATCCCAAGGGAGTCGGGGGAGGG + Intergenic
905589114 1:39146712-39146734 GGTCACAGGGAAGTGGGGGATGG + Intronic
905653520 1:39671872-39671894 ATGCACGGGTATGCGGGGGACGG - Intronic
905709213 1:40086531-40086553 GTTTACAGGGAGGTGGGGTATGG + Intronic
906528353 1:46509401-46509423 ATTCCCTGGAGGGCGGGGGAAGG + Intronic
906651540 1:47516359-47516381 CTTCACAGGGTGGCAGGAGAAGG - Intergenic
907063699 1:51457854-51457876 ATTAACTGGGAGGCGGGGTAAGG + Intronic
907303532 1:53502196-53502218 AGGGACAAGGAGGCGGGGGAGGG + Intergenic
908615416 1:65915693-65915715 GTTTACAGAGAGGAGGGGGAGGG - Intronic
908769240 1:67581290-67581312 ATAGAAAGGGAGTCGGGGGAAGG + Intergenic
908926450 1:69260644-69260666 TTTCAGAGGGTGGAGGGGGAAGG + Intergenic
910064682 1:83139357-83139379 ATTCACGGGGGGGTGGGGGAAGG + Intergenic
912052188 1:105542863-105542885 CTTCACAGGGAGGCAGGAGAGGG + Intergenic
912547422 1:110460942-110460964 ATCCAGAGGGAGGCCGGGGTGGG + Intergenic
912798081 1:112704947-112704969 AGTCACAGGGAGGGGTGGGCAGG - Intronic
914456410 1:147841140-147841162 ACCCAGAGGGAGGCGGGGGAAGG - Intergenic
918095809 1:181333162-181333184 ATTCACGGTGAGGCAGTGGAGGG + Intergenic
918454604 1:184695980-184696002 AGAGACAGGGAGGCAGGGGAAGG - Intronic
919780620 1:201218522-201218544 GTTCACAGAGAGGAGGTGGACGG + Exonic
920509029 1:206537038-206537060 AGACTCAGGGAGGCGAGGGAAGG - Intronic
920854446 1:209651683-209651705 ATTCTGAAGGAGGCTGGGGAAGG + Intronic
921016427 1:211196148-211196170 TTTTACATGGGGGCGGGGGATGG - Intergenic
922214664 1:223510493-223510515 CTTCACAAGGCGGCGGGGGGTGG + Intergenic
922811860 1:228420560-228420582 ATACCTAGGGAGGCTGGGGAAGG + Intergenic
1063077913 10:2734841-2734863 TATCACAGGGACGCGGGGGCTGG - Intergenic
1063215956 10:3925604-3925626 ATTCACCGGGAGGCATGGGATGG + Intergenic
1065021576 10:21506261-21506283 ATTTGAAGGGAGGCGGGGGGAGG + Intergenic
1066370387 10:34814767-34814789 AGGCGCAGGGAGGCGGGGAAAGG - Intronic
1067209888 10:44251261-44251283 AGTCACATGGAGGTGGGGAAGGG + Intergenic
1068132600 10:52913060-52913082 GTTCACAGGGAGGCAGAGGTGGG + Intergenic
1069416807 10:68207854-68207876 ACTCACAGGGAGGGTGGGGTGGG - Intronic
1071163505 10:82778890-82778912 AGTGACTGGGATGCGGGGGAGGG + Intronic
1072502217 10:96028988-96029010 GTTCAGAGGGAGGTGGGGAATGG + Intronic
1072542392 10:96408025-96408047 ATTCCCTGGGAGTGGGGGGAGGG + Intronic
1073048835 10:100655184-100655206 AGACACAGCGAGGCGGGGGAGGG - Intergenic
1073288242 10:102401023-102401045 CTTCAGAAGGAGGCGGGTGAGGG - Exonic
1073291261 10:102414405-102414427 ATTAGCAGGGAGGGAGGGGATGG - Intronic
1073396017 10:103218206-103218228 ATTCAAAGTGAGGCAGGGGTGGG + Intergenic
1073573336 10:104599318-104599340 ATTCAGAGGGAGCAGGTGGAGGG + Intergenic
1073677163 10:105661313-105661335 ATTCACGGGGTGGTGGGGCAGGG + Intergenic
1073897436 10:108179412-108179434 TTTCATAGGGAGGTGGGGGAAGG - Intergenic
1074469662 10:113715444-113715466 TTTCACAGGGAGCCCTGGGAGGG + Intronic
1075301488 10:121328590-121328612 AATCACAGTGAGGCCGGGCACGG - Intergenic
1075787091 10:125057397-125057419 GTTTAGAGGGAGGCGGGGGCTGG - Intronic
1076210678 10:128642220-128642242 ATTCACAGGCTGGAGGAGGATGG + Intergenic
1076588446 10:131567133-131567155 AGTTGCAGGGAGGTGGGGGAGGG + Intergenic
1076859404 10:133133555-133133577 GTGCCCAGGGAGGCAGGGGACGG + Intergenic
1077389725 11:2294653-2294675 AATGACAGGGTGGCTGGGGAAGG + Intergenic
1079910482 11:26303540-26303562 ATTAAGAGGGAGACGGAGGAAGG + Intergenic
1080222930 11:29927368-29927390 TCTCACATGGAGGCTGGGGATGG - Intergenic
1081575772 11:44317807-44317829 AATGAAAGGGAGGAGGGGGAAGG - Intergenic
1081668803 11:44932035-44932057 ATTAACAGGGACCCTGGGGAGGG - Exonic
1082873301 11:57963381-57963403 ATTCACAGGGAGAGAGAGGAAGG - Intergenic
1083254730 11:61489131-61489153 GTTCCCACGGAGGTGGGGGAGGG + Intronic
1083303340 11:61750104-61750126 ACTGACAGGGAGGCTGGGGTGGG + Intergenic
1083774150 11:64885039-64885061 TATCACCGGGAGGCAGGGGAAGG - Intronic
1084459359 11:69287567-69287589 TTTCCCAGGAAGTCGGGGGAGGG - Intergenic
1085094562 11:73749353-73749375 ACTCACAGGGAAGTGGGAGAGGG + Intronic
1088676807 11:112202158-112202180 AATCTCAGGAAGGCTGGGGAAGG + Exonic
1089466369 11:118689060-118689082 GAGCCCAGGGAGGCGGGGGAAGG + Intergenic
1090187383 11:124747206-124747228 GTTCAGAGGGTGCCGGGGGAGGG + Exonic
1091254704 11:134173260-134173282 GATCCCAGGGAGGCGGGGGATGG + Intronic
1091740647 12:2958953-2958975 AGTCCCTGGGAGGCCGGGGAAGG - Intergenic
1091987944 12:4928300-4928322 AGTCCCAGGGAGGCTGAGGAGGG + Intronic
1092249493 12:6884762-6884784 CACCACAGGGACGCGGGGGAGGG - Intronic
1095511690 12:42957841-42957863 ATTCACTGAGAGGAGAGGGAAGG - Intergenic
1095676256 12:44922401-44922423 ATTCACAGGGATGAGGTGGGGGG - Intergenic
1096193884 12:49636590-49636612 ATACCCAGGGTGGTGGGGGAAGG - Exonic
1096795574 12:54075545-54075567 ATTCCTGGGGAGGCGGGGGCTGG - Intergenic
1096866334 12:54565840-54565862 ATTCCCAGGGATGCCGGGGGAGG - Intronic
1097178972 12:57160075-57160097 ATGGACAGGGAAGCAGGGGAAGG + Intronic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1098161517 12:67650294-67650316 ACCCACGGGGAGGTGGGGGAAGG - Intronic
1098870814 12:75815059-75815081 ATGCACAGGAAGGTGGGGGATGG - Intergenic
1099455448 12:82857308-82857330 ATTCACACGGAGGCAGTGGCAGG + Exonic
1099638258 12:85245150-85245172 ATTCACAGGGTGTGGGGGGCAGG - Intronic
1100809991 12:98328114-98328136 ATTCACTGGGAGGCCGAGGAGGG + Intergenic
1102483816 12:113242759-113242781 ATTCACAGGGTGGATGGGGATGG - Intronic
1102988319 12:117296726-117296748 AATCACATGGGGGTGGGGGATGG - Intronic
1103198685 12:119068808-119068830 AGAAACAGAGAGGCGGGGGATGG + Intronic
1103629499 12:122248242-122248264 AGTCACAGGGAGCCAAGGGAAGG - Intronic
1103956094 12:124577722-124577744 AAGCACAGGGTGGCTGGGGAAGG + Intergenic
1104088101 12:125493907-125493929 ATTTCCAGGGAGGAGGAGGAGGG - Intronic
1106907700 13:34425778-34425800 AAGCACAGGGAGTCGGGGGTGGG + Intergenic
1107645653 13:42492006-42492028 ATTCATAGGGAGGAGAAGGACGG + Intergenic
1107829589 13:44362512-44362534 ATACACAGGATGGAGGGGGATGG + Intergenic
1108712601 13:53048629-53048651 ATTAGCATGGAGGCGGGGAAGGG - Intronic
1113205647 13:107912933-107912955 CTTCACAGGGAAGCAGGAGAGGG - Intergenic
1113459390 13:110471343-110471365 ATGAACAGGGAGGCTGGGGCAGG + Intronic
1114270461 14:21097822-21097844 AAGCACGGGGTGGCGGGGGAGGG - Intronic
1116689472 14:48086413-48086435 TTTGGCAGGGAGGCGGGAGATGG + Intergenic
1117729837 14:58711295-58711317 ATTCATAGGGAGGCTGGGCACGG - Intergenic
1119153119 14:72383792-72383814 TTTCAAAGGGTGGGGGGGGACGG + Intronic
1120331016 14:83092659-83092681 GTACCCACGGAGGCGGGGGAAGG - Intergenic
1120373592 14:83670990-83671012 TTTCACAGGGCGGCAGGAGAGGG + Intergenic
1121006115 14:90491726-90491748 ACGCACAGGCAGGCGGGGGGAGG - Intergenic
1121078787 14:91090809-91090831 GTGCACAGGGAGGGTGGGGATGG + Intronic
1121558272 14:94855010-94855032 AGACACAGTGAGGCAGGGGAGGG - Intergenic
1122218999 14:100223234-100223256 ATTAAAAGGGAGGAGGGGGTGGG + Intergenic
1122282202 14:100629982-100630004 ATTCACATGGAGACGGGACAGGG - Intergenic
1122404659 14:101492947-101492969 CTTCCCAGGGAGGCTGGGGTGGG - Intergenic
1122688149 14:103519622-103519644 TTTCCCAGGGGGGAGGGGGAAGG - Intergenic
1122707213 14:103629003-103629025 GGTCACAGGGAGGAGGGTGACGG - Intronic
1123794900 15:23761602-23761624 ATTCATAGAGAGGCTGGGGGAGG + Intergenic
1124805863 15:32882045-32882067 ATTGACAGGCAGGAGGTGGAAGG + Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1128228393 15:66018385-66018407 TTTCACAGGGAGGAGTCGGAGGG - Intronic
1128517796 15:68354055-68354077 ATGCACAGGGTGGTGGGGAAAGG - Intronic
1129661787 15:77556728-77556750 AATAAAAGGGAGGCAGGGGAGGG + Intergenic
1130688854 15:86062798-86062820 GGTCACAGGGAGGCGAGGGGAGG + Intergenic
1130906918 15:88247232-88247254 TTTTACAGGCAGGCGGGGAAAGG - Intronic
1131258422 15:90876190-90876212 AGTCCCCGGGAGGCGGGGGACGG - Intronic
1131330209 15:91491029-91491051 ACTCACAGGGAGGATGGGGTAGG + Intergenic
1132514585 16:360206-360228 AAGCAGAGGGAGGCGGCGGAGGG - Intergenic
1132720593 16:1313805-1313827 GATCACCGGGAGGCGGGGGCAGG - Intronic
1132801755 16:1758110-1758132 ACGCACAGAGAGGCAGGGGAAGG - Intronic
1135520466 16:23172943-23172965 ATGCACAGTGGGGCTGGGGAGGG - Intergenic
1137655588 16:50154890-50154912 ATGCAGAGGGTGGCGTGGGATGG + Intronic
1139259714 16:65579817-65579839 ATTCACAGGGTGGTTGGGAAGGG + Intergenic
1140782160 16:78306692-78306714 ATTCACAGGGAATTGTGGGAAGG - Intronic
1141991221 16:87611496-87611518 ATTCATAGGTAGGAGGGAGATGG - Intronic
1142380526 16:89729463-89729485 AGTGAGCGGGAGGCGGGGGAGGG + Intronic
1142590260 17:1001730-1001752 GCTCCCAGGGAAGCGGGGGATGG + Exonic
1143109340 17:4544684-4544706 GCGCACAGGGAGGCGGGGGTGGG + Intronic
1143109349 17:4544706-4544728 GCGCACAGGGAGGCGGGGGTGGG + Intronic
1144273265 17:13640559-13640581 AGAGACAGGGAGGCAGGGGAAGG - Intergenic
1144644478 17:16962844-16962866 CTTCACCGGGGGCCGGGGGAGGG + Intronic
1145040825 17:19577035-19577057 ATTCACAGGGAAGCCGGGCGCGG - Intronic
1145254733 17:21316384-21316406 AGCCACAGGAAGACGGGGGAGGG - Intergenic
1145321867 17:21771581-21771603 AGCCACAGGAAGACGGGGGAGGG + Intergenic
1147743706 17:42682792-42682814 GTTCACAGGGAGGCGGCTGCCGG + Exonic
1147796716 17:43048867-43048889 AGTCACAGAGAGGAGGGGGAGGG + Intronic
1150213613 17:63454965-63454987 ACCCACAGGGAGGGGAGGGAGGG - Intergenic
1150595869 17:66604037-66604059 CTTCAGTGGGAAGCGGGGGAAGG - Intronic
1150732808 17:67710566-67710588 ATTCACAGGGAGGGCGCAGAGGG - Intergenic
1151115838 17:71733916-71733938 CTACACAGGGAGGAGGAGGAGGG - Intergenic
1151598156 17:75090396-75090418 GGTCCCAGAGAGGCGGGGGAAGG + Intronic
1152554045 17:81044241-81044263 CTTCACAGGGAGGGGATGGATGG + Intronic
1152693500 17:81732561-81732583 ATTCACAGAGAGGCAGCGGGCGG - Intergenic
1153800170 18:8661871-8661893 ATTCACAGGAAGGAGAGGAAGGG - Intergenic
1153913995 18:9729648-9729670 ATTTAGAGGGGGGTGGGGGAGGG - Intronic
1154095740 18:11413582-11413604 ACTCACAGGGAGACAGGGGTGGG - Intergenic
1158440576 18:57471124-57471146 ATGCAAAGGGAGGCGGGACAGGG - Intronic
1158618890 18:59013140-59013162 AACCCCAGGGAGGCGGGAGAAGG - Intergenic
1160020035 18:75173121-75173143 ATCCACAGGAAGCGGGGGGATGG + Intergenic
1160560119 18:79750926-79750948 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160560190 18:79751131-79751153 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160765027 19:803788-803810 ATTTCCAGGGAGGCGCTGGATGG + Intronic
1161297230 19:3526225-3526247 AAGCACAGTGAGGCGGGGCAAGG - Intronic
1163427216 19:17246112-17246134 GGGCAGAGGGAGGCGGGGGAGGG - Intronic
1164193586 19:22933729-22933751 ATTCACAGGTAGGTTGGTGACGG + Intergenic
1164718859 19:30416605-30416627 CTTCCCAGGGAGGATGGGGAGGG - Intronic
1166851745 19:45764646-45764668 ATGCACAGAGTGGCTGGGGAGGG - Intergenic
1167228779 19:48268374-48268396 GTTCACATGGAGGCCGGGCACGG + Intronic
1167311570 19:48740361-48740383 AGTCAGAGGGAGGAGGGGGCTGG + Intronic
1167467718 19:49658866-49658888 GCTCACAGGGAGGCAGGGGCCGG + Intergenic
1168687469 19:58357475-58357497 GTTCCGAGGGAGGCAGGGGACGG - Exonic
925122086 2:1427321-1427343 ATGTCCAGGGAGGCAGGGGAGGG + Intronic
925291569 2:2751658-2751680 TTTCCCAGGGAGGCGGGCGATGG - Intergenic
926686746 2:15704096-15704118 TTCCCCAGGGAGGCTGGGGAGGG + Intronic
928725910 2:34172917-34172939 CTTCACAGGGTGGCAGGAGAGGG + Intergenic
929583274 2:43097988-43098010 GTGCACAGGGAGGCCAGGGAGGG + Intergenic
929626234 2:43410716-43410738 ATTGCCAGGGAGGTGGGGGAGGG + Intronic
930095248 2:47561581-47561603 CTTCACAGAGAGGCAGGGCAGGG + Intronic
932408965 2:71534060-71534082 TTTTACAGGGAGGAGGGGGAAGG + Intronic
932820577 2:74896252-74896274 CTTCAGAGGGTGGAGGGGGAAGG + Intergenic
933849258 2:86352530-86352552 ATTCTCAGGGTGGCAGTGGAGGG - Intergenic
935706346 2:105860784-105860806 ATGCACAGGCGGGCGGGGCATGG - Intronic
936115479 2:109699356-109699378 CTGCACAGGGAGGCGGGTGGGGG - Intergenic
936561199 2:113541473-113541495 ACTCCCAGGGAGACAGGGGACGG + Intergenic
936832914 2:116670827-116670849 ATTCAAAAGTAGTCGGGGGAAGG - Intergenic
937295549 2:120807863-120807885 ATGCTCAGGGTGGCGGGGGCGGG - Intronic
938784352 2:134611555-134611577 GTTCACTGGGAGGAGGGGTAGGG + Intronic
941181150 2:162260859-162260881 AGTAACAGGGGGGCAGGGGAGGG + Intergenic
941295837 2:163736838-163736860 ATTCACAGGGAGGCGGGGGAGGG - Intergenic
942389335 2:175476006-175476028 ATTCAAAATGAGGCGGGGTATGG + Intergenic
942450095 2:176103929-176103951 ACTCAGAGGGCGGCGGGGAAGGG + Intergenic
942484756 2:176427148-176427170 ATTCACAGGAAGGCGGGAGCAGG + Intergenic
942960757 2:181827929-181827951 ATTCCCAAGGAGGTGGAGGAGGG + Intergenic
945572060 2:211480463-211480485 CTTCACATGGTGGCAGGGGAGGG - Intronic
945921632 2:215761196-215761218 ATTGAGAGGGAGGAGAGGGAAGG - Intergenic
945980304 2:216304705-216304727 ATTCATAGGGAGGCTGAGGTGGG + Intronic
948755197 2:240155374-240155396 AGTCAGAGGGAGGAGGGCGATGG - Intergenic
1168764029 20:369714-369736 AGTCATGGGGAGGCAGGGGAGGG - Intronic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1170039592 20:12025923-12025945 ATTCTCAGGGAGGCAGAGGCAGG - Intergenic
1170562634 20:17570174-17570196 GGTCGCAGGGACGCGGGGGAGGG - Exonic
1172321144 20:33995729-33995751 GTTAACAGGGAAGCGGGGAAAGG - Intronic
1172944225 20:38675044-38675066 ATTTGCAGGGAGGCTGGGGGTGG + Intergenic
1173361936 20:42352360-42352382 AACCTTAGGGAGGCGGGGGAAGG + Intronic
1173874213 20:46359628-46359650 ATTGACAGGGAGGCTGGGAGTGG - Intronic
1174648264 20:52104230-52104252 ATTCCAGTGGAGGCGGGGGATGG + Intronic
1174779000 20:53371179-53371201 ATTCACAGGTAGGAGGGGTCAGG + Intronic
1175032000 20:55963829-55963851 ATTCACAGGTAGGCCAGGCATGG - Intergenic
1175089914 20:56493969-56493991 AGGCACAGGGAGGAGGGGCAGGG - Intronic
1176081266 20:63274317-63274339 ATTCACTGGGCGGGGGGGGGGGG - Intronic
1176424140 21:6537509-6537531 ATTCATAGGGAGGGTGAGGAAGG + Intergenic
1178370553 21:32023569-32023591 AGTCAGAGGGAGCTGGGGGAGGG - Intronic
1179500165 21:41803650-41803672 AGTCACAGGCATGGGGGGGACGG - Intronic
1179699633 21:43145824-43145846 ATTCATAGGGAGGGTGAGGAAGG + Intergenic
1181855312 22:25777384-25777406 ACTCACAGGGAGCCAGGGGCAGG + Intronic
1181903158 22:26171369-26171391 ATTCAAAAGGGGGTGGGGGAGGG - Intronic
1182739512 22:32557297-32557319 ATTCACAAGGGGAGGGGGGATGG + Intronic
1183422398 22:37719463-37719485 ATGCTCAGGGAAGCAGGGGATGG + Intronic
1183474125 22:38026586-38026608 AGTTCCAGGGAGCCGGGGGAGGG - Intronic
1183650136 22:39148968-39148990 AGTCTCCGGGAGGCGGGGCAGGG + Intronic
1183653451 22:39171875-39171897 AAACACAGGCAGACGGGGGATGG - Intergenic
1183666534 22:39249372-39249394 GTAGACAGGGAGGCAGGGGATGG - Intergenic
1183852033 22:40598204-40598226 ATTCTCTAGGAGGCTGGGGAGGG - Intronic
1184297220 22:43532428-43532450 AGGCCCAGGGAGGCGGAGGAAGG + Intronic
1184482128 22:44753831-44753853 TTTCACAGGCAAGCGAGGGACGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1184565429 22:45288990-45289012 ACCCACAGGGAGGCGGTGGGGGG - Intronic
1184943134 22:47783100-47783122 CTCCACAGGGAGGAGGGAGATGG + Intergenic
1185075173 22:48679059-48679081 ATGGACAGGGAGACGGGAGAGGG - Intronic
1185075181 22:48679082-48679104 ATGGACAGGGAGCCGGGAGAGGG - Intronic
1185075189 22:48679105-48679127 ATGGACAGGGAGCCGGGAGAGGG - Intronic
1185075197 22:48679128-48679150 ATGGACAGGGAGCCGGGAGAGGG - Intronic
1185075212 22:48679174-48679196 ATGGACAGGGAGCCGGGAGAGGG - Intronic
1185075437 22:48679765-48679787 ATGGACAGGGAGCCGGGAGAGGG - Intronic
1185417223 22:50716809-50716831 ATGCACAGGTGGGCAGGGGACGG - Intergenic
950390128 3:12690038-12690060 ATTGACAGGGAGGCTGAGGCAGG - Intergenic
952248120 3:31619982-31620004 ATTCACTGAGAGGCTGGGCATGG + Intronic
952723215 3:36555067-36555089 AATCACAGGCAGCTGGGGGATGG + Intergenic
952952233 3:38534086-38534108 ATTCACTGGGATGGGGTGGAGGG + Intronic
954389832 3:50262886-50262908 AGGCACAGGGAGGCGGGAGATGG - Intergenic
954409269 3:50363328-50363350 ATGGACTGGGAGGAGGGGGAGGG - Intronic
954633092 3:52057379-52057401 GTTGAGAGGGAGGCAGGGGAAGG - Intergenic
955213363 3:56962579-56962601 ATTCACAGGAAAGCCAGGGATGG + Intronic
955556553 3:60143911-60143933 ATTAACTGGGAGGTGGGGTAGGG + Intronic
957987788 3:87593805-87593827 ATTCACAAGGTGGCAGGAGAAGG + Intergenic
958028600 3:88078780-88078802 ATTCTTAGGGAGATGGGGGATGG + Intronic
958141720 3:89570916-89570938 AGTCACGGGGAGGTGGGGGGGGG + Intergenic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
961201680 3:125050443-125050465 ATAGACAGGGAGGTGGAGGATGG - Intronic
962169844 3:133089267-133089289 GTGCACAGGGAGGCATGGGAAGG + Intronic
966682827 3:182661480-182661502 TTTCACAGGGAAGTGGTGGAAGG + Intergenic
967015654 3:185479287-185479309 ATTGACAGGGAGGTGAGGGATGG + Intronic
967710116 3:192697046-192697068 ACTAACTGAGAGGCGGGGGAGGG - Intronic
969452062 4:7279855-7279877 ATTAATTGGGGGGCGGGGGAGGG - Intronic
969900695 4:10346450-10346472 TTTCTCAGGGAGTCTGGGGATGG + Intergenic
970790738 4:19854760-19854782 TTTCACAGGGAAGTGGGGCACGG + Intergenic
971363028 4:25954175-25954197 ATGCACAGGGAGGCAGCGTAAGG + Intergenic
972557744 4:40197428-40197450 ATTTACAGGGGGACGGGGGTCGG + Intronic
975973376 4:80069155-80069177 AGTAACAGAGAGGCCGGGGAAGG + Intronic
976163022 4:82223768-82223790 ATTCACAGGTAGCAGGGGTAAGG - Intergenic
976287703 4:83386125-83386147 CTTCACATGGTGGCAGGGGAAGG + Intergenic
978133162 4:105224493-105224515 ATTTTCAGAGAGGCGGGAGAAGG + Intronic
979783208 4:124682068-124682090 ATGCACAGGGAGGCCGAGGCGGG + Intronic
982860682 4:160445096-160445118 ATTACCAGGTATGCGGGGGATGG - Intergenic
983166422 4:164482351-164482373 AGTCAGAGGGAGGGTGGGGAGGG + Intergenic
984645024 4:182210013-182210035 CGGCACAGGGAGGCTGGGGAGGG - Intronic
985280194 4:188278621-188278643 ATTCACAGATAGGTGAGGGAAGG + Intergenic
986990240 5:13543898-13543920 ATTCACAGGGAGGCTGCACAAGG - Intergenic
987747925 5:22001299-22001321 ATTAATAAGGAGGAGGGGGACGG - Intronic
988086952 5:26485364-26485386 GAACCCAGGGAGGCGGGGGAAGG + Intergenic
988155989 5:27449287-27449309 CTTCACAGGGTGGCAGGAGAGGG - Intergenic
989736037 5:44708044-44708066 ATAGACAGGGAGGCAGGGCAGGG - Intergenic
990794659 5:59525835-59525857 ATTCACATGGCGGCAGGGGAGGG - Intronic
991020933 5:61979738-61979760 ATTCAGGGGGAGCTGGGGGAAGG - Intergenic
992892157 5:81213447-81213469 GTTCACAGCAAGGCAGGGGAGGG - Intronic
992905263 5:81339292-81339314 ATTCTCATGGAGCCGGGGGAGGG - Intronic
993517671 5:88857713-88857735 CTTCACAGGGTGGCAGGAGAGGG - Intronic
997968129 5:138376266-138376288 ATGCACAGGGAGGTTGGGTATGG - Intronic
998148418 5:139743665-139743687 ATTGACAGGGAAGGGGCGGAGGG + Intergenic
998567134 5:143225781-143225803 AGCCACAGGGAAGCTGGGGAGGG - Exonic
1000329153 5:160193980-160194002 GTGCCCACGGAGGCGGGGGAAGG + Intronic
1001670393 5:173468697-173468719 ATTCAGCGGGAGGAGGAGGAAGG + Intergenic
1002542714 5:179916833-179916855 ATCCAGAGGGAGGGGAGGGAAGG - Intronic
1003442698 6:6158591-6158613 CTTCATGGGGAGGCCGGGGATGG - Intronic
1007717202 6:43864217-43864239 ATTCACAGGGAGGGAGGGAGGGG - Intergenic
1008967648 6:57329646-57329668 CTTCACAGGGCGGCAGGGGAGGG - Intronic
1009624904 6:66126699-66126721 ATCCACACAGAGACGGGGGATGG + Intergenic
1009808661 6:68634802-68634824 ACTCACTGGGAGGCGAGGCAGGG - Intergenic
1009966509 6:70584133-70584155 AATCCCAGGGAGGCTGAGGAAGG - Intronic
1010258081 6:73783158-73783180 AGTCACAGGGAGAAGGGGCATGG + Intronic
1013591649 6:111623809-111623831 AGCAACAGGGAGGTGGGGGAGGG - Intergenic
1016518048 6:144918790-144918812 ATAGACAGGGAGGCAGGGGATGG - Intergenic
1017729625 6:157303818-157303840 ATTCTCATGGTGGCGGGGGGAGG + Intronic
1019450933 7:1097582-1097604 TTTCAGAGGGAGACGGGGGCAGG + Intronic
1019642024 7:2108658-2108680 TTTCACAGGGAGCCAGGGGTTGG + Intronic
1022183807 7:27947733-27947755 ATCCACAGTGAGGAAGGGGATGG - Intronic
1023662063 7:42479976-42479998 ATTCAAAGGGTGGGGGAGGAAGG + Intergenic
1023907636 7:44533619-44533641 ATTGACAGGGTGCAGGGGGAAGG + Intronic
1024303351 7:47904700-47904722 TTTAAGAGGAAGGCGGGGGAGGG + Intronic
1024432408 7:49303993-49304015 ATTCATATGGAGGCTGGGCATGG - Intergenic
1026817592 7:73524107-73524129 CGTCTCAGGGAGGCGGGGGGGGG + Intergenic
1026879787 7:73901153-73901175 AATAACAGGGAGGCCGGGCACGG - Intergenic
1027279430 7:76595391-76595413 ATTCACGGGGGGGTGGGGGAAGG - Intergenic
1028572296 7:92304004-92304026 ATTAACAGGAAGGTGGGGTAGGG - Intronic
1029029809 7:97455646-97455668 ATTCAGATGGAGGTGGGAGAAGG - Intergenic
1029163196 7:98567557-98567579 ATTGATAGAGGGGCGGGGGAGGG + Intergenic
1030384276 7:108848663-108848685 ATGCACAGGCAGGTGGGGGCGGG - Intergenic
1031478232 7:122248275-122248297 TTTCACAAGGAGGCAGGGGCAGG - Intergenic
1032262722 7:130349997-130350019 ATCCACAGGGAGGCTGGGCCTGG - Exonic
1032481189 7:132248503-132248525 AGTCAAATGGAGGAGGGGGAAGG + Intronic
1034421269 7:150992363-150992385 CTTCCCAGTGAGGCAGGGGATGG - Intronic
1035426899 7:158784051-158784073 AGGCACAGGGAGGAGGAGGAGGG + Intronic
1035766220 8:2107701-2107723 ACTCACAGGCAGGGTGGGGAAGG + Intronic
1036382764 8:8248614-8248636 ACTCACAGGGAGGCTGAGGCAGG + Intergenic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1037774119 8:21821637-21821659 ATTCCCGGGGAGGGGAGGGAAGG - Intergenic
1038405977 8:27323259-27323281 ATTCACAGGGAGGGCTGGAACGG + Exonic
1038729759 8:30116368-30116390 ATGGACAGGGAGGCGGGGGATGG + Intronic
1040015158 8:42693539-42693561 AGTCACAGTGAGGTGGGGGCGGG - Intergenic
1040340028 8:46435802-46435824 AGCCGCAGGGAGGCGTGGGAGGG - Intergenic
1040385762 8:46914115-46914137 ATTAGCAGGGAGACTGGGGAGGG - Intergenic
1044616748 8:94150286-94150308 ATTCAGAGTGGGGTGGGGGACGG + Intronic
1045251748 8:100488493-100488515 AGTGACAGGGAGGCTGAGGAAGG + Intergenic
1047248719 8:123166063-123166085 ATACAGAGGGAGTCGGGGGCTGG + Intergenic
1047700861 8:127448131-127448153 TTTCACAGGGAGGAAGAGGAAGG + Intergenic
1049393539 8:142384272-142384294 CTTCTCAGAGAGGCAGGGGATGG - Intronic
1050144622 9:2553541-2553563 TTTCAGAGGGAGGCAGGAGATGG + Intergenic
1051901295 9:22044692-22044714 AGGCACAGGAAGGAGGGGGAGGG - Intergenic
1052142418 9:25003860-25003882 AGGCAGAGGGTGGCGGGGGAGGG + Intergenic
1053047125 9:34929049-34929071 TTTGACATGGAGGTGGGGGAGGG - Intergenic
1055742551 9:79405973-79405995 ATTAACAGGGTGGGTGGGGATGG - Intergenic
1057018965 9:91681125-91681147 ACTCACTGGGAGGCTGCGGATGG + Intronic
1058320327 9:103622141-103622163 ATTCACAGGGCGGCGGGAAGGGG + Intergenic
1058747776 9:108008468-108008490 ATTCTCAGAGAGGCAGAGGAAGG + Intergenic
1059178865 9:112193020-112193042 ATTGCTAGGGAGGCTGGGGAAGG - Intergenic
1059364991 9:113780047-113780069 ATTAACAGGGAGGCTGAGGCAGG - Intergenic
1060103953 9:120862133-120862155 CTTCACAGGGAGGCCTGGGGAGG + Intronic
1060295293 9:122339127-122339149 ATGGACAGGGAGGCAAGGGAAGG - Intergenic
1061127427 9:128685733-128685755 CTTCAAAGGGAGCCGGGGGCCGG + Intronic
1061295702 9:129675610-129675632 ACAGACAGGGAGGCGGGGGTGGG - Intronic
1061625833 9:131840218-131840240 ATCCACGGGGAGGCAGGGAATGG + Intergenic
1061809356 9:133153478-133153500 ACTGACAGGGAGGCGGGACAGGG + Exonic
1061906300 9:133701040-133701062 ATACTCAGGGAGGCCAGGGATGG + Intronic
1062125908 9:134862573-134862595 ATCCATAGGGAGGCTGGGGGTGG + Intergenic
1062566804 9:137167232-137167254 ATTCAGAGGGAGGCGTGGGTGGG + Intronic
1062567242 9:137168703-137168725 ATACACCGGGAGGTGGGGGTTGG - Exonic
1186493907 X:9996860-9996882 ATCCACAGGGTGGTGGGAGATGG - Intergenic
1190274439 X:48891290-48891312 AGTTGCAGGGAGGCTGGGGACGG - Intergenic
1190618512 X:52262570-52262592 GGTTACAGGGGGGCGGGGGAAGG - Intergenic
1190939657 X:55028144-55028166 TTTCACAAGCAGGCAGGGGAAGG - Intronic
1192134732 X:68586557-68586579 CTTCACAGGGTGGCAGGAGAGGG - Intergenic
1192134745 X:68586620-68586642 CTTCACAGGGTGGCAGGAGAGGG - Intergenic
1194522352 X:94934910-94934932 CTTCACAGGGTGGCAGGAGAGGG - Intergenic
1194720753 X:97337495-97337517 CTTCACAGGGTGGCAGGGGAGGG - Intronic
1197305983 X:124842636-124842658 ATTCACAGGGTGGAGAGGGAGGG + Intronic
1198534693 X:137574496-137574518 AGCCACGGGGAAGCGGGGGAGGG - Intronic
1200009616 X:153111335-153111357 AGTCATTGGAAGGCGGGGGATGG - Intergenic
1200029984 X:153288587-153288609 AGTCATTGGAAGGCGGGGGATGG + Intergenic
1201583901 Y:15539340-15539362 AGTCACATGGAAGCTGGGGATGG + Intergenic