ID: 941297341

View in Genome Browser
Species Human (GRCh38)
Location 2:163756649-163756671
Sequence CCATAACAACACTAAGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941297337_941297341 23 Left 941297337 2:163756603-163756625 CCACTCGTAGGCAACCAAGAGCT No data
Right 941297341 2:163756649-163756671 CCATAACAACACTAAGAATATGG No data
941297336_941297341 24 Left 941297336 2:163756602-163756624 CCCACTCGTAGGCAACCAAGAGC No data
Right 941297341 2:163756649-163756671 CCATAACAACACTAAGAATATGG No data
941297338_941297341 9 Left 941297338 2:163756617-163756639 CCAAGAGCTTCTTTGCAGACAAA No data
Right 941297341 2:163756649-163756671 CCATAACAACACTAAGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941297341 Original CRISPR CCATAACAACACTAAGAATA TGG Intergenic
No off target data available for this crispr