ID: 941300583

View in Genome Browser
Species Human (GRCh38)
Location 2:163796062-163796084
Sequence AATTTTGAAGAGATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941300583_941300586 0 Left 941300583 2:163796062-163796084 CCTGGCTCCATCTCTTCAAAATT No data
Right 941300586 2:163796085-163796107 CTCTTGGCTCTACCCTCTCTAGG No data
941300583_941300590 27 Left 941300583 2:163796062-163796084 CCTGGCTCCATCTCTTCAAAATT No data
Right 941300590 2:163796112-163796134 GACTTCATTCTCAATGCTAGTGG No data
941300583_941300587 5 Left 941300583 2:163796062-163796084 CCTGGCTCCATCTCTTCAAAATT No data
Right 941300587 2:163796090-163796112 GGCTCTACCCTCTCTAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941300583 Original CRISPR AATTTTGAAGAGATGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr