ID: 941303819

View in Genome Browser
Species Human (GRCh38)
Location 2:163835706-163835728
Sequence CCTTCTTCCCTGAAGGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941303819_941303823 7 Left 941303819 2:163835706-163835728 CCGACCACCTTCAGGGAAGAAGG No data
Right 941303823 2:163835736-163835758 GAATGTGAGAGTGATCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941303819 Original CRISPR CCTTCTTCCCTGAAGGTGGT CGG (reversed) Intergenic
No off target data available for this crispr