ID: 941310074

View in Genome Browser
Species Human (GRCh38)
Location 2:163916807-163916829
Sequence TTGAATAAGCAAGAGTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941310072_941310074 24 Left 941310072 2:163916760-163916782 CCACAGTAAGAACTCATTATGTG No data
Right 941310074 2:163916807-163916829 TTGAATAAGCAAGAGTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941310074 Original CRISPR TTGAATAAGCAAGAGTAACA GGG Intergenic
No off target data available for this crispr