ID: 941319352

View in Genome Browser
Species Human (GRCh38)
Location 2:164034963-164034985
Sequence AATACAAAACCAGCTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941319352_941319357 -7 Left 941319352 2:164034963-164034985 CCACACCCAGCTGGTTTTGTATT No data
Right 941319357 2:164034979-164035001 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
941319352_941319355 -9 Left 941319352 2:164034963-164034985 CCACACCCAGCTGGTTTTGTATT No data
Right 941319355 2:164034977-164034999 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
941319352_941319359 16 Left 941319352 2:164034963-164034985 CCACACCCAGCTGGTTTTGTATT No data
Right 941319359 2:164035002-164035024 TTTCTCCACGTTTGTCAGGCTGG 0: 12
1: 1023
2: 21634
3: 45265
4: 152514
941319352_941319358 12 Left 941319352 2:164034963-164034985 CCACACCCAGCTGGTTTTGTATT No data
Right 941319358 2:164034998-164035020 GGGGTTTCTCCACGTTTGTCAGG 0: 12
1: 712
2: 14641
3: 38593
4: 139078
941319352_941319356 -8 Left 941319352 2:164034963-164034985 CCACACCCAGCTGGTTTTGTATT No data
Right 941319356 2:164034978-164035000 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941319352 Original CRISPR AATACAAAACCAGCTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr