ID: 941319353

View in Genome Browser
Species Human (GRCh38)
Location 2:164034968-164034990
Sequence CTAAAAATACAAAACCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941319353_941319359 11 Left 941319353 2:164034968-164034990 CCCAGCTGGTTTTGTATTTTTAG No data
Right 941319359 2:164035002-164035024 TTTCTCCACGTTTGTCAGGCTGG 0: 12
1: 1023
2: 21634
3: 45265
4: 152514
941319353_941319358 7 Left 941319353 2:164034968-164034990 CCCAGCTGGTTTTGTATTTTTAG No data
Right 941319358 2:164034998-164035020 GGGGTTTCTCCACGTTTGTCAGG 0: 12
1: 712
2: 14641
3: 38593
4: 139078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941319353 Original CRISPR CTAAAAATACAAAACCAGCT GGG (reversed) Intergenic
No off target data available for this crispr