ID: 941319354

View in Genome Browser
Species Human (GRCh38)
Location 2:164034969-164034991
Sequence ACTAAAAATACAAAACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35115
Summary {0: 8, 1: 702, 2: 16541, 3: 11068, 4: 6796}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941319354_941319359 10 Left 941319354 2:164034969-164034991 CCAGCTGGTTTTGTATTTTTAGT 0: 8
1: 702
2: 16541
3: 11068
4: 6796
Right 941319359 2:164035002-164035024 TTTCTCCACGTTTGTCAGGCTGG 0: 12
1: 1023
2: 21634
3: 45265
4: 152514
941319354_941319358 6 Left 941319354 2:164034969-164034991 CCAGCTGGTTTTGTATTTTTAGT 0: 8
1: 702
2: 16541
3: 11068
4: 6796
Right 941319358 2:164034998-164035020 GGGGTTTCTCCACGTTTGTCAGG 0: 12
1: 712
2: 14641
3: 38593
4: 139078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941319354 Original CRISPR ACTAAAAATACAAAACCAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr