ID: 941319355

View in Genome Browser
Species Human (GRCh38)
Location 2:164034977-164034999
Sequence TTTTGTATTTTTAGTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 489276
Summary {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941319350_941319355 21 Left 941319350 2:164034933-164034955 CCGAGTAGCTGGGACTACAGGCG 0: 42478
1: 106370
2: 174364
3: 132619
4: 206690
Right 941319355 2:164034977-164034999 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
941319347_941319355 25 Left 941319347 2:164034929-164034951 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 941319355 2:164034977-164034999 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
941319349_941319355 22 Left 941319349 2:164034932-164034954 CCCGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 941319355 2:164034977-164034999 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
941319352_941319355 -9 Left 941319352 2:164034963-164034985 CCACACCCAGCTGGTTTTGTATT No data
Right 941319355 2:164034977-164034999 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941319355 Original CRISPR TTTTGTATTTTTAGTAGAGA TGG Intergenic
Too many off-targets to display for this crispr