ID: 941319356

View in Genome Browser
Species Human (GRCh38)
Location 2:164034978-164035000
Sequence TTTGTATTTTTAGTAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 618077
Summary {0: 86734, 1: 238723, 2: 156972, 3: 78020, 4: 57628}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941319349_941319356 23 Left 941319349 2:164034932-164034954 CCCGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 941319356 2:164034978-164035000 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
941319352_941319356 -8 Left 941319352 2:164034963-164034985 CCACACCCAGCTGGTTTTGTATT No data
Right 941319356 2:164034978-164035000 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
941319347_941319356 26 Left 941319347 2:164034929-164034951 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 941319356 2:164034978-164035000 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
941319350_941319356 22 Left 941319350 2:164034933-164034955 CCGAGTAGCTGGGACTACAGGCG 0: 42478
1: 106370
2: 174364
3: 132619
4: 206690
Right 941319356 2:164034978-164035000 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941319356 Original CRISPR TTTGTATTTTTAGTAGAGAT GGG Intergenic
Too many off-targets to display for this crispr