ID: 941319358

View in Genome Browser
Species Human (GRCh38)
Location 2:164034998-164035020
Sequence GGGGTTTCTCCACGTTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941319353_941319358 7 Left 941319353 2:164034968-164034990 CCCAGCTGGTTTTGTATTTTTAG No data
Right 941319358 2:164034998-164035020 GGGGTTTCTCCACGTTTGTCAGG No data
941319354_941319358 6 Left 941319354 2:164034969-164034991 CCAGCTGGTTTTGTATTTTTAGT No data
Right 941319358 2:164034998-164035020 GGGGTTTCTCCACGTTTGTCAGG No data
941319352_941319358 12 Left 941319352 2:164034963-164034985 CCACACCCAGCTGGTTTTGTATT No data
Right 941319358 2:164034998-164035020 GGGGTTTCTCCACGTTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941319358 Original CRISPR GGGGTTTCTCCACGTTTGTC AGG Intergenic