ID: 941319359

View in Genome Browser
Species Human (GRCh38)
Location 2:164035002-164035024
Sequence TTTCTCCACGTTTGTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220448
Summary {0: 12, 1: 1023, 2: 21634, 3: 45265, 4: 152514}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941319354_941319359 10 Left 941319354 2:164034969-164034991 CCAGCTGGTTTTGTATTTTTAGT 0: 8
1: 702
2: 16541
3: 11068
4: 6796
Right 941319359 2:164035002-164035024 TTTCTCCACGTTTGTCAGGCTGG 0: 12
1: 1023
2: 21634
3: 45265
4: 152514
941319352_941319359 16 Left 941319352 2:164034963-164034985 CCACACCCAGCTGGTTTTGTATT No data
Right 941319359 2:164035002-164035024 TTTCTCCACGTTTGTCAGGCTGG 0: 12
1: 1023
2: 21634
3: 45265
4: 152514
941319353_941319359 11 Left 941319353 2:164034968-164034990 CCCAGCTGGTTTTGTATTTTTAG No data
Right 941319359 2:164035002-164035024 TTTCTCCACGTTTGTCAGGCTGG 0: 12
1: 1023
2: 21634
3: 45265
4: 152514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941319359 Original CRISPR TTTCTCCACGTTTGTCAGGC TGG Intergenic
Too many off-targets to display for this crispr