ID: 941320249

View in Genome Browser
Species Human (GRCh38)
Location 2:164046016-164046038
Sequence GCAAAAGTATGATGAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 3, 1: 7, 2: 24, 3: 91, 4: 423}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941320249 Original CRISPR GCAAAAGTATGATGAGAAAC AGG Intergenic
900275285 1:1822146-1822168 GAAAAAGAATGAAAAGAAACGGG - Intronic
903886339 1:26543110-26543132 GCAGAAGTAGGAAGAGTAACGGG + Intronic
904368635 1:30034589-30034611 GCACAAGGATGCTGAGAAGCAGG - Intergenic
904950053 1:34230146-34230168 GTAAAAGTTTGATGGGGAACAGG - Intergenic
905437592 1:37968151-37968173 GCAAAAGGATCATGTGAAATGGG + Intronic
907000497 1:50848476-50848498 GCAAAAGTTTAATAAGAAACAGG + Intronic
907071246 1:51536989-51537011 GCAAAAGTTTGAAGAGGAACAGG - Intergenic
907231026 1:52998621-52998643 GCAAAAGTATGGACAGACACAGG - Intronic
907397047 1:54198424-54198446 GCAAGAGAATGATGTGAACCCGG - Intronic
908066450 1:60410681-60410703 GCTAAGGTATGATGAGTATCAGG - Intergenic
909155606 1:72071656-72071678 GCAAAAGTGGGATGAGAGAGGGG - Intronic
909563763 1:77032825-77032847 GCAAAAGAATTATGAGAACTTGG - Intronic
910671747 1:89780702-89780724 TCAAAAAGATCATGAGAAACAGG + Intronic
912600926 1:110932743-110932765 GCAAAAGTTCGAGGAGAAATAGG - Intergenic
912647520 1:111408241-111408263 ATAAAAATATGATAAGAAACAGG - Intergenic
913420413 1:118661039-118661061 GCAGAAGTCTGATTAGAATCTGG - Intergenic
914229857 1:145755795-145755817 GAAAAAATCTGATTAGAAACTGG + Intronic
914920374 1:151842922-151842944 GCAAAAGTATGATGAGAAACAGG + Intergenic
915878549 1:159641059-159641081 ACAACAGTATTATGAGAAAATGG - Intergenic
915946727 1:160158156-160158178 GCCACAGAATTATGAGAAACAGG - Intronic
916416284 1:164595013-164595035 ATAAAAGTATGAACAGAAACCGG - Intronic
916608050 1:166362621-166362643 GATAAAGTTTGATGAGAAATGGG - Intergenic
917045593 1:170856456-170856478 ACAAAAGTATGACAAGAAATAGG + Intergenic
917186061 1:172357223-172357245 GTAAAAGTATGATGAGAAACAGG + Intronic
917203530 1:172543693-172543715 GCAAAGGTTTAATTAGAAACAGG + Intronic
917785076 1:178446431-178446453 TAAAAAGGATGAAGAGAAACAGG + Intronic
917990928 1:180377985-180378007 CCATAAGTTTGAGGAGAAACAGG + Intronic
918773327 1:188593150-188593172 GAAAAATTATTATGAGAAACTGG + Intergenic
920141779 1:203820951-203820973 GTTGAAGTCTGATGAGAAACGGG - Intronic
920681398 1:208075587-208075609 ATGAAAGTATGATGAGAAATAGG - Intronic
921621501 1:217330603-217330625 GCAAAGAGATGATGTGAAACTGG - Intergenic
921752186 1:218808389-218808411 GGACAAGTGGGATGAGAAACAGG - Intergenic
922203530 1:223426958-223426980 GCAGAAGAATGAAAAGAAACTGG + Intergenic
922448884 1:225720516-225720538 GCAGAAGAATGATGTGAACCTGG + Intergenic
922519278 1:226234218-226234240 GTAAAAGTTTGATGACAAATAGG - Intronic
923154148 1:231261641-231261663 GGTAAAGTATGATGCAAAACAGG - Intronic
1063152904 10:3353006-3353028 GCAAAAGTAGGTTGACATACAGG + Intergenic
1063816460 10:9780008-9780030 GCAAAAATTTGAAGAGAAACAGG - Intergenic
1065132034 10:22631785-22631807 GCAAAAGTATGCTGAGAAACAGG + Intronic
1065327604 10:24562994-24563016 GCAAAAGTATCATGACAAGGTGG + Intergenic
1066013203 10:31213131-31213153 GTAAAAGTTTGATGAGGAAAAGG - Intergenic
1066700913 10:38127124-38127146 AAAAATGTAAGATGAGAAACTGG + Intergenic
1066972744 10:42329199-42329221 GCAGAAGAATGGTGTGAAACTGG - Intergenic
1067361018 10:45578573-45578595 GTGAAAGTTTGATGAGGAACAGG + Intronic
1067784961 10:49239037-49239059 ACAAATGTATGATGTGTAACAGG + Intergenic
1067809310 10:49415005-49415027 GCAAAAGTTGGATGAGGAATAGG + Intergenic
1067815191 10:49469148-49469170 ATAAAAGTTTGATGAGAAACAGG + Intronic
1068245135 10:54356001-54356023 GTAAAAGTTCAATGAGAAACAGG + Intronic
1068287462 10:54959140-54959162 GGAAAAGGATGAAGAGAAAAAGG + Intronic
1068598211 10:58926989-58927011 GCAAAAGTCTGAGGAGACACAGG + Intergenic
1068894218 10:62181585-62181607 GCAAAAGAATGGCGAGAACCTGG + Intergenic
1069131321 10:64707324-64707346 TTAAAAGTTTGACGAGAAACGGG - Intergenic
1069379934 10:67832731-67832753 GTAAAAGTTTGAGAAGAAACAGG + Intronic
1069462689 10:68610187-68610209 GCAAGAGAATGATGTGAACCCGG + Intronic
1070204122 10:74238952-74238974 GCATAAGTATCATTTGAAACTGG - Intronic
1070473185 10:76804034-76804056 ACAAAAGTGTGATGAGAAACAGG - Intergenic
1071447635 10:85763427-85763449 GATAGAGTATGATGAGAAAATGG - Intronic
1071745945 10:88419544-88419566 GCAAAAGAATAAAAAGAAACAGG - Intronic
1071747262 10:88436243-88436265 GTAAAAGTGTGATGAGACCCAGG + Intronic
1071752639 10:88498035-88498057 GTGAAAGTTTGATGAGAAACAGG + Intronic
1072883138 10:99248504-99248526 GCAAAAAAATGATGTAAAACTGG + Intergenic
1074369060 10:112884444-112884466 GGAAAAGTATGATGACAAAGAGG - Intergenic
1075141991 10:119846469-119846491 GTGAAAGTTTAATGAGAAACTGG + Intronic
1076389226 10:130085191-130085213 GCAAAAGTTTAAGGAGAAACTGG + Intergenic
1078581520 11:12542840-12542862 CCACAAGTATGTTCAGAAACTGG - Intergenic
1078723958 11:13911389-13911411 GTGAAAGTTTGATGAGAAACAGG - Intergenic
1078917230 11:15790161-15790183 GTAAAATTTTGATGAGAAACAGG + Intergenic
1079149962 11:17889185-17889207 GCAAAAGTCTGAAGAGGAAAAGG + Intronic
1079411694 11:20193635-20193657 TTAAAACTTTGATGAGAAACAGG - Intergenic
1079961885 11:26934453-26934475 GCAAAAGCATAATCAGATACTGG + Intergenic
1080043760 11:27786741-27786763 GAAAAAGTATGATGAAAAAAGGG + Intergenic
1080148174 11:29015216-29015238 GCGTAAGTATGAGTAGAAACAGG + Intergenic
1080149635 11:29035799-29035821 GCAAAAGTAATAGGAGAAGCAGG + Intergenic
1080262973 11:30369933-30369955 CAAAAAGTGTGATGAGAAACAGG - Intergenic
1080301958 11:30794456-30794478 GTAAAAATTAGATGAGAAACAGG - Intergenic
1080769028 11:35323328-35323350 GGAAAAGTATGAGGATAAAATGG + Intronic
1080831917 11:35902508-35902530 GTAAAGGTAGAATGAGAAACAGG + Intergenic
1080993517 11:37571495-37571517 GAAAAAGCAAGATAAGAAACTGG + Intergenic
1083916302 11:65745976-65745998 GCAAAAGCATGGTGAGGAACAGG - Intergenic
1084163492 11:67364117-67364139 GCAAGAGTCTGATGAGCACCAGG + Intronic
1084583989 11:70044646-70044668 GTAAATGTTTGATGAGGAACAGG + Intergenic
1084757362 11:71248300-71248322 CAAGAAGTATGATGAGAAACTGG + Intronic
1085227846 11:74938485-74938507 GTAAAAGTATGATGAGAAACAGG - Intronic
1085722437 11:78924283-78924305 GCAAAACCAGGATGAGAATCTGG + Intronic
1087109173 11:94444474-94444496 GGAAAAGAAGGATGAGAAAAGGG + Intronic
1087124018 11:94605581-94605603 GTAAAAGTTTGATGAGGAACAGG - Intronic
1087515267 11:99152332-99152354 ACAAAGATATGATGAGACACAGG - Intronic
1087708339 11:101520940-101520962 GCAAAGGAATGATCTGAAACTGG + Intronic
1088466856 11:110148889-110148911 GATAAAGAATGATGAAAAACAGG - Intronic
1088688089 11:112301674-112301696 GGCAGAATATGATGAGAAACAGG - Intergenic
1089481474 11:118808859-118808881 GGAAAACTATGATAAGGAACAGG + Intergenic
1090169148 11:124582858-124582880 GCAAGAGTATGATGTGGAAGAGG - Intergenic
1090236323 11:125150733-125150755 GCAAAAGAATGGTGTGAACCCGG - Intergenic
1090563116 11:127955159-127955181 GTAAAAGTATGATGAGAAATGGG + Intergenic
1090637733 11:128701994-128702016 GCAAAAGTGTGAAAACAAACAGG + Intronic
1090943753 11:131411425-131411447 TCAAAGGTAAGATGAGAAAGAGG + Intronic
1091057019 11:132429083-132429105 GCAACAGCATGATGTGTAACGGG + Intronic
1091502844 12:1035977-1035999 TAAAAAGTATGATGATAATCTGG - Intronic
1092189552 12:6508661-6508683 GCAAAAATGTGATGTGAAACAGG + Intronic
1092796451 12:12114591-12114613 GCAAAATTTTGATTAGAAATGGG - Intronic
1092807439 12:12237461-12237483 ATAAAAGTATGATGAGAAACAGG + Intronic
1092812216 12:12282091-12282113 TCAAAAGTTTGATGAGGAATGGG + Intergenic
1093440058 12:19184361-19184383 GCAAATGTTTAATGAGAAAGGGG - Intronic
1093568919 12:20643208-20643230 GAAGAAGTATGATGAGAATAAGG + Intronic
1093985260 12:25523962-25523984 GCAAAAGTAGTATGAGAAGTAGG + Intronic
1094030669 12:26008177-26008199 GCAAGAGAATGATGTGAACCCGG + Intronic
1094040567 12:26116946-26116968 GCAAAAGTATTCTGGGGAACTGG - Intergenic
1094634649 12:32213875-32213897 GCAAAAGTATGATGAGAAACAGG - Intronic
1094702552 12:32884122-32884144 GCAGAAGTCTGATGAGACAAAGG - Intronic
1094767595 12:33615577-33615599 GCTCAAGTTTGATGAAAAACAGG + Intergenic
1095144400 12:38707911-38707933 GCTATAGGATGAAGAGAAACAGG + Intronic
1095844368 12:46729757-46729779 GCAAAAGTTACATGAGAAAGTGG - Intergenic
1095882403 12:47152156-47152178 ACAAAAATGTGATGAGAAATAGG + Intronic
1096867741 12:54575292-54575314 GCAAAAGGAGGATGTGGAACAGG - Intronic
1097128695 12:56794243-56794265 GTTAAAGTTTGATGAGGAACAGG - Intergenic
1099399400 12:82183530-82183552 GAGAAAGTATGATGAGACATTGG - Intergenic
1099727118 12:86445462-86445484 GCAAAAGCAGTTTGAGAAACTGG + Intronic
1100118087 12:91333939-91333961 ATAAAAGTATAGTGAGAAACAGG + Intergenic
1101508720 12:105373424-105373446 GCAAAACTCTAAGGAGAAACAGG - Intronic
1101793616 12:107953111-107953133 GCAAGAGAATGATGTGAACCCGG - Intergenic
1102384048 12:112492506-112492528 AAAAAAGTATTATGAGAAATAGG - Intronic
1102442967 12:112977781-112977803 CCACAAGTGTGCTGAGAAACTGG + Intergenic
1103315612 12:120052680-120052702 GCAAAAGTTTCATGAGAAACAGG - Intronic
1103889874 12:124230477-124230499 GTAAAAATATGAAGAGAAAGGGG - Intronic
1104613146 12:130246361-130246383 GTGAAAGTTCGATGAGAAACAGG + Intergenic
1106001222 13:25725209-25725231 GCAAAATGATTAAGAGAAACTGG - Intronic
1106575913 13:30974822-30974844 TGAAAAGTATGAAGAAAAACAGG - Intronic
1107466334 13:40654047-40654069 GCAAAACTGTGATGAGAAAGAGG - Intronic
1107472744 13:40705488-40705510 GCAAAAGTTTGAGAAGAAACAGG + Intergenic
1107491301 13:40881969-40881991 GCAAAAGTTTGAGAAGAAACAGG + Intergenic
1107696940 13:43009624-43009646 GTAAAAGTTTGATGAGGACCAGG - Intergenic
1108162661 13:47658182-47658204 GCAAGAAAATGATGAGAAAAGGG - Intergenic
1108193352 13:47965952-47965974 GCAGAAGAATGGTGAGAACCCGG + Intronic
1108225583 13:48285675-48285697 GCAAAAGTATGATGAGCGAGTGG - Intergenic
1108293336 13:48985464-48985486 GAAAATGTATGATGGGAAACTGG + Intronic
1109185578 13:59263812-59263834 GCAAAAATATGAGGAAAACCAGG + Intergenic
1109526959 13:63588302-63588324 GCAAAAATATTATAATAAACAGG - Intergenic
1110531912 13:76607685-76607707 GCAAAGGGAGGATGATAAACAGG - Intergenic
1110655087 13:77988364-77988386 GCAAGAGTATAATGAAAAAGTGG - Intergenic
1110695870 13:78487698-78487720 GCAAAAGGTGGAGGAGAAACTGG - Intergenic
1111040192 13:82738376-82738398 GCAAGAGAATGATGTGAAGCTGG - Intergenic
1111757207 13:92413792-92413814 GCAAAAGCAGGATGAGAAGAGGG + Intronic
1112019085 13:95356180-95356202 GCAAAAGCATGAAGGCAAACAGG + Intergenic
1116056415 14:39869577-39869599 TCAAAAGGATGATGAGGAAATGG + Intergenic
1116450659 14:45060963-45060985 GCATATGTATGGTGAGAAATAGG - Intronic
1116512484 14:45764126-45764148 ATAAAAGTAATATGAGAAACAGG - Intergenic
1117217678 14:53568621-53568643 GGATAAGTATGCTGTGAAACTGG - Intergenic
1117382455 14:55178156-55178178 GCAGGAGAATGGTGAGAAACCGG + Intronic
1118563379 14:67112126-67112148 TCAAAAGCAAGATGAGAAAGAGG + Intronic
1119106440 14:71929637-71929659 GTAAAAGTTTGATGAGGAACAGG - Intergenic
1119184053 14:72625108-72625130 GCAAAAGTATGATGAGAAGTAGG - Intronic
1119676456 14:76559159-76559181 GTTAAAGTTTGATGAGGAACAGG + Intergenic
1120117909 14:80641994-80642016 GCAGAAGAATGATGTGAACCCGG + Intronic
1120646136 14:87076645-87076667 GCAAAAGTTTAAACAGAAACAGG - Intergenic
1122526311 14:102387618-102387640 GCAGGAGAATGATGTGAAACCGG - Intronic
1122624983 14:103080107-103080129 GCAAAAGAATGGTGAGAAGATGG + Intergenic
1124696459 15:31868580-31868602 GCCTAAGTGAGATGAGAAACTGG - Intronic
1125119589 15:36138371-36138393 GCAAAAGAATGGTGTGAACCCGG + Intergenic
1125225667 15:37392885-37392907 GCAAAAATTTGAAGAGGAACAGG - Intergenic
1125655503 15:41353448-41353470 GTGAAAGTTTCATGAGAAACAGG - Intronic
1125702457 15:41699459-41699481 ACCAAATTAAGATGAGAAACGGG - Intronic
1127124133 15:55795722-55795744 GGGAAAGTATGATGAGGAAATGG + Intergenic
1127132105 15:55877582-55877604 GAAAAAGTTTGATGAGAAATGGG - Intronic
1127496976 15:59522358-59522380 TCAGAAGTATGATGTAAAACTGG + Exonic
1129284327 15:74511948-74511970 GTAAAAGTTTTATGAGGAACAGG - Intergenic
1129535172 15:76308266-76308288 GTAAAAGTCTGATGAGAAATAGG + Intronic
1129551951 15:76461394-76461416 ACAAATGTAGGATGAGAAAGAGG - Intronic
1129654226 15:77512715-77512737 GTAAATTTTTGATGAGAAACAGG + Intergenic
1132162959 15:99560384-99560406 GTGAAAGGATGATGAGAAACAGG - Intergenic
1133448470 16:5883368-5883390 GAAAAAGTATTATGAGGAATAGG - Intergenic
1133663902 16:7946427-7946449 GCTCAAGTGTGCTGAGAAACAGG - Intergenic
1134154691 16:11833394-11833416 GCAGAAGAATGGTGAGAACCTGG - Intergenic
1134163216 16:11909215-11909237 GTAGAATTATGATGGGAAACTGG + Intronic
1134342684 16:13359607-13359629 GTAAAAGTATGGTGATAAATTGG - Intergenic
1134600738 16:15531628-15531650 TCAAAAAAATGATGAGAACCCGG - Intronic
1135498446 16:22973007-22973029 CCAAAAGTGTGATGTGAAAAGGG - Intergenic
1136171195 16:28490664-28490686 GCAAAAGAATGGTGTGAACCTGG + Intronic
1137334573 16:47534604-47534626 ATAAAATTATGAGGAGAAACAGG + Intronic
1137833403 16:51566723-51566745 GCAAAAGTTTAATGAGAAGTAGG + Intergenic
1138600826 16:58053022-58053044 TCAAAAGTATACTGAGAACCAGG + Intergenic
1138623195 16:58228130-58228152 GTGAAAGTACAATGAGAAACAGG + Intergenic
1138824616 16:60304001-60304023 GCAGGAGAATGATGAGAATCTGG + Intergenic
1139228653 16:65258678-65258700 GTAAAAGTATGATCAGAAGCTGG - Intergenic
1139951194 16:70671642-70671664 GCAAAAGTACAAGGAGAAACAGG + Intronic
1140561160 16:75983431-75983453 GCAAAAGGGTGATGAAAAACAGG - Intergenic
1141018359 16:80470990-80471012 GCAAAAGTATGATTCAAAACAGG + Intergenic
1141488930 16:84358975-84358997 GTCAAAGTTTAATGAGAAACAGG - Intergenic
1142822418 17:2480892-2480914 GTAAAAGTTTGTTGAAAAACAGG + Intronic
1142965057 17:3575570-3575592 GTGAAAGTCTGATGAGAAACAGG + Intronic
1143579358 17:7816597-7816619 GAAACAGTATGATGAGAAGCTGG + Exonic
1148722215 17:49762395-49762417 GTAAAAGTATGTTTAGAATCCGG - Intronic
1149106176 17:52969097-52969119 GTAAAAGTTTAATAAGAAACAGG - Intergenic
1149741087 17:59046205-59046227 GAAAAAGTAGGATGAAAAATAGG + Intronic
1150104516 17:62452419-62452441 GTAGAAGTTTGATGAGGAACAGG - Intergenic
1150199062 17:63334622-63334644 GCAAAAGTTTAAGGAGAAACAGG + Intronic
1150204641 17:63393692-63393714 ACAAAAGTATGACAAGAACCAGG - Intronic
1150550129 17:66202704-66202726 GCAGAAGAATGATGTGAACCGGG - Intergenic
1150718213 17:67590578-67590600 TGAAAAGTTTGATGAGGAACAGG + Intronic
1150936874 17:69645454-69645476 GCAAAAATTTTAGGAGAAACAGG - Intergenic
1151065137 17:71140083-71140105 GGAAAATTATAATGAGAAACAGG + Intergenic
1151427896 17:74043126-74043148 GAAAGAGAAGGATGAGAAACTGG + Intergenic
1153853327 18:9118159-9118181 CCCAAAGTGTGATGAGAATCAGG - Intronic
1154178275 18:12104514-12104536 GCAAAAGTATGAGGAAAACGTGG + Intronic
1155317138 18:24583194-24583216 GCAAAAGCAGCATGAGAAAAGGG - Intergenic
1155711221 18:28882373-28882395 GCAAAACTAAAATGAGAAACAGG - Intergenic
1156307894 18:35896208-35896230 TCAAAAGTTTGATGAGCAACAGG - Intergenic
1156577338 18:38333206-38333228 GCAAAAGTATGATGAGAAATAGG - Intergenic
1157015015 18:43701382-43701404 GGAGAAGGATGATGAGAGACAGG + Intergenic
1157131541 18:45012257-45012279 GCAAAAGGATGAAGGGAAAGTGG + Intronic
1157165308 18:45353352-45353374 GGAAAAGAATGATGGTAAACTGG + Intronic
1157456567 18:47835422-47835444 AAAAAAATTTGATGAGAAACAGG - Exonic
1157673136 18:49547589-49547611 GGTAAAGTATGATGAGGAAGGGG + Intergenic
1158150871 18:54368722-54368744 ACAAAAGTTTGAGGAGAAACAGG - Intronic
1158763263 18:60415732-60415754 GCAAGAGAATGGTGTGAAACCGG + Intergenic
1158783050 18:60675133-60675155 ACAAAAGTATGATGAAAAACAGG + Intergenic
1159029568 18:63217422-63217444 GGAAAAAAATGAGGAGAAACTGG + Intronic
1159114374 18:64096372-64096394 GCAAAAATATTTTGAAAAACAGG + Intergenic
1159754689 18:72349737-72349759 GAAAGAGGATGATGAGAAAGAGG + Intergenic
1160117689 18:76097191-76097213 GTGAAAGTATAATGAGAAATAGG + Intergenic
1160170633 18:76550204-76550226 GGCAAAATATGATGAGATACTGG - Intergenic
1161510993 19:4670789-4670811 GGGAAAGTAGGATGAGAAGCAGG + Intergenic
1162769788 19:12942267-12942289 GCAAAAGGATGACGTGAACCCGG + Intronic
1164745956 19:30613290-30613312 GCAGAAGTATGAAAAGAAAAAGG - Intronic
1165105340 19:33466031-33466053 CCAAAAGTATAATTAGACACTGG + Intronic
1165294892 19:34918617-34918639 GAAAAAGTTTGATGAGAGGCTGG - Intergenic
1165698206 19:37917361-37917383 GCAGATGTATGATGAAAAGCAGG + Intronic
1165889570 19:39102622-39102644 GTGAAAGTTTGAGGAGAAACAGG - Intronic
1166739348 19:45104655-45104677 TCACAAGTGTGATGTGAAACAGG - Intronic
1168700770 19:58438158-58438180 GCAAAAGTAGGATGAGAGTTGGG - Intronic
925488266 2:4361573-4361595 GTGAAAGTATAATGAGAAAAAGG + Intergenic
925704527 2:6671235-6671257 GTGAAAGTTTGATGAGAACCAGG + Intergenic
925934225 2:8738343-8738365 GCAAAAGTATAAGCAGAAACGGG + Intronic
926319819 2:11741715-11741737 GCAAGAGAATGATGTGAACCTGG + Intronic
926356320 2:12043923-12043945 GGAAAAGTATTTGGAGAAACAGG + Intergenic
926483781 2:13430951-13430973 GCAAAGGTATGCTGGAAAACAGG - Intergenic
927265361 2:21141799-21141821 GAAAAAGCATGATCAGAAATGGG + Exonic
927427036 2:22992904-22992926 GCAAAAATTTGACGAGAAACAGG - Intergenic
928011428 2:27611634-27611656 GCAACAGTATGATAAGAAACAGG - Intronic
928042826 2:27895675-27895697 ACAAAAGGATGATGAGAAACCGG - Intronic
928226438 2:29452580-29452602 AGGAAAGCATGATGAGAAACAGG + Intronic
928542552 2:32296798-32296820 GCTAAAGTTAGATGAGAAACAGG - Intronic
928727352 2:34190549-34190571 TTAAAAGTTTGATGAGTAACAGG - Intergenic
929732460 2:44510588-44510610 GGGAAAGTATAATGAGAAATGGG - Intronic
930371238 2:50503745-50503767 GCAAAATTTTGATGAGTTACAGG + Intronic
930434944 2:51328950-51328972 GCAAAAGCAGGATGAGAATCAGG - Intergenic
930623568 2:53669733-53669755 GCCAAAGAATGAAAAGAAACTGG + Intronic
930686370 2:54312777-54312799 GCAAAAGCATGATGGGAAACAGG - Intergenic
931120392 2:59211544-59211566 GTGAAATTGTGATGAGAAACAGG - Intergenic
931150067 2:59563105-59563127 GGAAATGTATGATAAGAAAAAGG + Intergenic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
931537012 2:63289164-63289186 GAAAAAGTTTCATGAAAAACAGG - Intronic
931562742 2:63580311-63580333 GTAAAAGTTTGGTGAGAAACAGG + Intronic
932225774 2:70039152-70039174 GCAAAAGTACTCTGAGGAACAGG + Intergenic
932749486 2:74362251-74362273 GCAAAAGTATGTTGATATAGAGG - Intronic
933623443 2:84571282-84571304 GCAAAAGTATAATAAGAAATGGG + Intronic
933643408 2:84788270-84788292 GGAAAAGGAAAATGAGAAACAGG - Intronic
933687118 2:85150830-85150852 GTAAAGGTTTGATGAGAAATGGG - Intronic
934965240 2:98715844-98715866 GTAAAAGTATGATAAGAAACAGG + Intronic
935026701 2:99283866-99283888 GAAAAATTTTGATGAGAAAAAGG - Intronic
935521913 2:104117702-104117724 GCAAAAATAAAATAAGAAACAGG - Intergenic
936139773 2:109929354-109929376 GCAATAGTATGGTGAGATAAAGG - Intergenic
936204923 2:110442132-110442154 GCAATAGTATGGTGAGATAAAGG + Intronic
936490478 2:112967352-112967374 GCAAAAGTTTGAGGAGATACAGG - Intergenic
937010951 2:118562177-118562199 TTGAAAGTCTGATGAGAAACGGG + Intergenic
937953210 2:127404246-127404268 GCAAAAATATGATGAGAAACAGG + Intergenic
939053796 2:137337600-137337622 GTAAAAGAATGATAAGAAACAGG - Intronic
939714205 2:145562644-145562666 GCAAAACAATGATGGGAAACAGG - Intergenic
939782235 2:146463676-146463698 GCAGAAGTATGGTGTGAACCTGG - Intergenic
940424766 2:153517793-153517815 GCAAAAGTTTGAAGAGAAAGAGG + Intergenic
940640268 2:156338001-156338023 GCAGAATTCTGATGAGAAAAAGG - Intronic
940770809 2:157837785-157837807 GCAAAAGTAGGAGGAGAAGGAGG + Intronic
941129875 2:161634457-161634479 GCAAAAGTTTGAGGAGAAATAGG - Intronic
941320249 2:164046016-164046038 GCAAAAGTATGATGAGAAACAGG + Intergenic
941671378 2:168297457-168297479 GCAAAAGCATGGTGAGAAACAGG - Intergenic
941791561 2:169557985-169558007 GGAAAAGTTTGTGGAGAAACTGG - Intronic
942282983 2:174385951-174385973 GCAAAAGTCCAAGGAGAAACAGG + Intronic
942304799 2:174596442-174596464 GAGAAAGGAAGATGAGAAACTGG - Intronic
942370692 2:175281091-175281113 GCAGAAGTATGATTAGATAAAGG + Intergenic
942470998 2:176259515-176259537 ACAAAAGTATGATTACAAACAGG + Intergenic
943362102 2:186931974-186931996 GCAGAAGAATGGTGAGAACCTGG + Intergenic
943429542 2:187782075-187782097 GGAAAAATGTAATGAGAAACAGG - Intergenic
943837713 2:192534776-192534798 GCAACAGTATGGAGAGAAAACGG - Intergenic
943930687 2:193848180-193848202 GCACATGAATGATGAAAAACAGG - Intergenic
944609839 2:201391490-201391512 GTAATAGTTTGATGAGGAACAGG + Intronic
945323022 2:208448538-208448560 GCAAGAGTATGGTGTGAACCCGG + Intronic
946237748 2:218334867-218334889 ACCCAAGTATGATGAGAAAGAGG - Intronic
946263242 2:218514685-218514707 ACAAAAGTTTGATGAGAAACAGG - Intronic
946479910 2:220045148-220045170 TCAAAAGTATGAGTAAAAACAGG + Intergenic
947032540 2:225813811-225813833 CCAAAAGTAGTATGAGAAACTGG + Intergenic
948558049 2:238830611-238830633 GTAAAAATAGGATGAAAAACAGG + Intergenic
1169533268 20:6508188-6508210 GTGAAAGTCTGATGAGAAAGAGG + Intergenic
1169723185 20:8701186-8701208 GAAAGAGTAAGAAGAGAAACAGG + Intronic
1169835152 20:9869719-9869741 GCAAAAATAGGATGAGTATCAGG + Intergenic
1170179657 20:13515600-13515622 CCCAAAGAATGCTGAGAAACAGG + Intronic
1170339538 20:15308204-15308226 TAAAAAGTTTGATGACAAACAGG - Intronic
1170497889 20:16944527-16944549 GTAAAAGTATGATGAGAAGCAGG - Intergenic
1170648979 20:18222154-18222176 GCAAAAGTTTGAGGAAAAACAGG + Intergenic
1170649409 20:18226444-18226466 GCAAAAGTTTGAGGACAAACAGG + Intergenic
1171012511 20:21516273-21516295 GAAAAAGTAGGAGGAGAAAGAGG - Intergenic
1171334973 20:24376092-24376114 GAAAAAATATAATGAGAAACAGG + Intergenic
1171542778 20:25977228-25977250 GGAAAAGTAGGATTACAAACTGG + Intergenic
1172496638 20:35390654-35390676 GCAAAAGTATAATGTGAAATGGG + Intronic
1172884730 20:38223409-38223431 TCAAATGAATGATGAAAAACAGG + Intronic
1173264325 20:41465159-41465181 ACAGAAGTAGGATGAAAAACAGG + Intronic
1174643322 20:52064008-52064030 GGAAAAGAATGATGACAAATGGG + Intronic
1174677977 20:52376843-52376865 GTAAAATTAAGGTGAGAAACAGG + Intergenic
1179204993 21:39268120-39268142 GTAAAAATTTAATGAGAAACAGG + Intronic
1180196638 21:46200334-46200356 GTATAAGTATGATGAGAAATAGG + Intronic
1180753868 22:18146677-18146699 TTAAAAGTTTGATGAGAAACAGG - Intergenic
1181529180 22:23506700-23506722 GCAAAAGAATGGTGTGAACCTGG + Intergenic
1181691702 22:24566146-24566168 GCAGAAGGTTTATGAGAAACTGG + Intronic
1182594363 22:31407260-31407282 GCAAAAGTTTGAGGAAAAACAGG - Intronic
1182596955 22:31429073-31429095 GCAAAAATTTGAAGAGAAAAAGG - Intronic
1184069492 22:42139287-42139309 GCAAAAGAATGATGGCAACCAGG - Intergenic
949331966 3:2932914-2932936 GCAAGAGAATGATGTGAACCCGG - Intronic
949759185 3:7450011-7450033 GTAAAAGAATAATGACAAACTGG + Intronic
951188474 3:19741634-19741656 GCAACAGAATGATGAGAAAGTGG + Intergenic
951662247 3:25081545-25081567 GCAAAAGTAAAAGGAGAAATAGG - Intergenic
951743607 3:25951654-25951676 GCAACAGTATGATGAGACCATGG + Intergenic
952113350 3:30150035-30150057 TTAAAAGTTTGATGAGGAACAGG + Intergenic
952267902 3:31804030-31804052 GTGAAACTATGATGAAAAACAGG - Intronic
952316190 3:32234638-32234660 GTGAAAGTGTGATGAGAAAAAGG - Intergenic
952757557 3:36885062-36885084 GCAGAAGTTTGAGAAGAAACAGG + Intronic
952839559 3:37633160-37633182 GCAATAGAATGATGAGCAAGTGG + Intronic
952979025 3:38720385-38720407 GCATAAGCAAGATGAGAAAGAGG + Intronic
953137116 3:40190567-40190589 GCAAAACCAAGATGAGAATCTGG - Intronic
953432132 3:42848662-42848684 ACAAAAGCATGATGAGAAATAGG + Intronic
953720794 3:45353298-45353320 GCAAAAGAGTGATGAGAAACAGG - Intergenic
954768732 3:52945871-52945893 AAAATACTATGATGAGAAACAGG + Intronic
954942723 3:54389426-54389448 GCAAAAGTTTGGTGAAGAACAGG + Intronic
955240930 3:57177369-57177391 ACAAAAGTTTGAGGAGTAACAGG - Intergenic
955510994 3:59680016-59680038 GGAAAAGTCTGATGAGAGTCTGG + Intergenic
955545579 3:60025406-60025428 CCAAGAGAATGATTAGAAACAGG + Intronic
956438141 3:69254427-69254449 GTGAAAGTTTGATGAGAAACAGG + Intronic
956732428 3:72208798-72208820 GTAAAAGTTTGAGGAGTAACAGG + Intergenic
958812517 3:98878110-98878132 GTATAAGTTTGATGAGTAACAGG + Intronic
959932514 3:111999479-111999501 GCAGAAGTATGATGCGGACCTGG + Exonic
960262724 3:115586755-115586777 GTGAAAGTTTGATAAGAAACAGG + Intergenic
960281463 3:115785054-115785076 GCAACAGTTTGATGGGAAATGGG + Intergenic
960546769 3:118923995-118924017 GCAAAAGTTTGATGGGAAGCAGG - Intronic
961768739 3:129232536-129232558 GCAAAAGAATGGTGTGAACCTGG - Intergenic
962461798 3:135621113-135621135 GTGAAAGTTTGATAAGAAACAGG - Intergenic
962501036 3:135992820-135992842 GCATATATAAGATGAGAAACGGG + Intronic
964140404 3:153392136-153392158 GCAGAAGAATGATGTGAACCCGG + Intergenic
964387099 3:156159373-156159395 CTAAAAGTAAGAAGAGAAACTGG + Intronic
964873120 3:161335074-161335096 GCAAAAGTTTGAGGAGAAGTAGG + Intergenic
965227154 3:166004363-166004385 GTAAAAGTAGGATGAGATACGGG + Intergenic
965362506 3:167758569-167758591 TCAAAGATATGATGAGTAACAGG + Intronic
965362603 3:167760060-167760082 TCAAAGGTATGATGAGAAACAGG - Intronic
965798726 3:172468701-172468723 GCAGAAGAATGAAGAGAACCTGG + Intergenic
965998956 3:174923539-174923561 GCAAAAGTTTGAGGAGAAGCAGG + Intronic
966976537 3:185088742-185088764 GTGAAAGTATGGTGACAAACAGG - Intronic
970092106 4:12421463-12421485 GCAAGAGGATGAAGAGAACCAGG - Intergenic
970329662 4:14966587-14966609 GCAAAATATAGATGAGAAACTGG - Intergenic
972025385 4:34370038-34370060 GAAAAAGTAGGAGGAGAAACCGG - Intergenic
973570128 4:52230285-52230307 GCAAAAATATGATGATAGATTGG + Intergenic
973660658 4:53103082-53103104 GGAAAAGTTTGATGAGAAGCAGG + Intronic
973785919 4:54332645-54332667 CCAAAAGTGTCATGAGAAAGAGG - Intergenic
975150754 4:71018218-71018240 GCACAAGAATGATGTGAACCTGG - Intronic
975561576 4:75713350-75713372 GTGAAAGTTTGATGAGAAACAGG + Intronic
975642185 4:76511834-76511856 GGAAAAGGATGGTGAGAAAGTGG + Intronic
975738862 4:77408724-77408746 AGAAAAGTATGAGGAGATACTGG + Intronic
976559637 4:86486711-86486733 GGAAAAGTTAGATGAGGAACAGG + Intronic
978172852 4:105694694-105694716 GCAAAAGTATGAAAACATACGGG + Intronic
978858739 4:113424354-113424376 GCCAAAGTATGGTGAGAGAGGGG + Intergenic
980251908 4:130327091-130327113 GCTACAGTTTGATGACAAACAGG - Intergenic
981454977 4:144942955-144942977 GCAAAAATACAGTGAGAAACAGG + Intergenic
982185581 4:152794612-152794634 GCAATAGTTTGAGGAGAAACAGG - Intronic
982685899 4:158488636-158488658 ATAAAAGTAAGATGAGAAAAAGG + Intronic
984140408 4:175998662-175998684 GCAAAAGATTGATGAGAGATAGG - Intronic
984241172 4:177220923-177220945 GCAAAGATTTGAGGAGAAACAGG + Intergenic
985351552 4:189068616-189068638 GGAAAAGGATGCTGAGAAAAGGG + Intergenic
985701691 5:1377358-1377380 GCAAAATTAGGATGAGAAATGGG - Intergenic
986520346 5:8609653-8609675 GCAAAAGTAGAATGAGGAAAAGG + Intergenic
986782056 5:11075488-11075510 GCCAAAGGATGATGGCAAACTGG + Intronic
989659441 5:43783881-43783903 GCTAAAGATTGATGAGAAACGGG - Intergenic
990213829 5:53508842-53508864 GCAAAAAGATTATCAGAAACTGG - Intergenic
990285883 5:54300260-54300282 GCAAACGTACCAAGAGAAACTGG - Intronic
991352130 5:65730222-65730244 GCAAAAGTAAAATGGGAAAGGGG + Intronic
991379967 5:66010497-66010519 GTAAAAGTATGATGAAAAACAGG - Intronic
991631467 5:68660667-68660689 GGAAAGGCATGATGGGAAACTGG + Intergenic
992007405 5:72491347-72491369 GAAGAAGGATGATGAGAAAAAGG + Intronic
993475489 5:88359044-88359066 GAGAAAGTATGCTGAGAAAGAGG + Intergenic
993698873 5:91094741-91094763 GAAAAAGTGTGATGAGAAGAGGG + Intronic
994256423 5:97601593-97601615 GCAAAAGTAAGAGGTCAAACTGG - Intergenic
995906674 5:117132454-117132476 GCAAGAGTATAAGGAGAAAAAGG - Intergenic
995906779 5:117134254-117134276 ACAAAAGTATAAGGAGAAAAAGG - Intergenic
996972019 5:129382534-129382556 ACACAAGTAAGGTGAGAAACAGG + Intergenic
997028576 5:130095715-130095737 GCAAAAGTATAAGCAAAAACAGG + Intronic
999533671 5:152491858-152491880 ATAAAAGTTTGATGAGAAACAGG - Intergenic
1000230165 5:159308583-159308605 GTAGAAGTATGATGAGAAAAAGG + Intergenic
1000339134 5:160263766-160263788 GCTAAAGGTTGTTGAGAAACAGG - Intronic
1000392259 5:160736328-160736350 GCAAAGGTATGATGATAAATGGG + Intronic
1001292020 5:170470408-170470430 GTAAAAGTCTGCTGAGAGACAGG - Intronic
1001796700 5:174508230-174508252 GCAAAGGTATGCTGTGAAAGGGG + Intergenic
1001932186 5:175681087-175681109 GAAAAACTTTGATGAGAAATAGG + Intronic
1002095927 5:176831054-176831076 GCAACAGAAGGATGAGGAACGGG - Intronic
1003196898 6:3922648-3922670 GCAAAATTATTAGGACAAACTGG - Intergenic
1003307723 6:4944747-4944769 GTAAAAGTGTGATGAGAAAAAGG + Intronic
1003667938 6:8128951-8128973 AAAAAAGTATAATGAGAAACTGG - Intergenic
1004286686 6:14327701-14327723 GCGAAAGTTTGATGACAAACAGG + Intergenic
1004543645 6:16575221-16575243 GCAAAAGTATATGCAGAAACAGG - Intronic
1004564650 6:16784736-16784758 CCAAAGGTATGATTAGAAATTGG + Intergenic
1004738776 6:18435557-18435579 GGCAAAGTTTGATTAGAAACAGG + Intronic
1004769235 6:18763141-18763163 GTAAAAGTTTGATGAAGAACTGG + Intergenic
1004889362 6:20084607-20084629 GTGAAAGTTTGATGAGAAACAGG - Intergenic
1005531367 6:26709838-26709860 ACAAAAATATGAGGAAAAACAGG + Intergenic
1005539429 6:26791800-26791822 ACAAAAATATGAGGAAAAACAGG - Intergenic
1005869049 6:29959741-29959763 GCAAAAAAATGATCTGAAACTGG + Intergenic
1007564004 6:42834394-42834416 GTGCAAGTTTGATGAGAAACTGG - Intronic
1008048222 6:46873316-46873338 GCAAAGACTTGATGAGAAACGGG - Intronic
1008938161 6:57015332-57015354 GCATCAGACTGATGAGAAACAGG + Exonic
1008964158 6:57297535-57297557 GCTAACACATGATGAGAAACAGG + Intergenic
1009010253 6:57833977-57833999 ACAAAAATATGAGGAAAAACAGG - Intergenic
1009780145 6:68259399-68259421 GCAAATGTCTGATGAGATTCAGG + Intergenic
1009903536 6:69839621-69839643 ACAAAAATATAATGAGAAAAAGG - Intergenic
1010326217 6:74565589-74565611 GCAAAAGTAAGGGGAAAAACTGG + Intergenic
1010863129 6:80938058-80938080 GCTAAAGTATTGTGAGAAAAGGG - Intergenic
1011111386 6:83840258-83840280 GTAAAAGTTTAATGAGAAACAGG + Intergenic
1011750770 6:90452543-90452565 GTAAAAGTTTGATGAGCAATAGG - Intergenic
1012444684 6:99295869-99295891 GCCAAAGTTTGAGGAGAAACAGG - Intronic
1012726145 6:102813328-102813350 GCAAAAGTTTAATGAGGATCAGG - Intergenic
1012952538 6:105534042-105534064 GTAAAAGGATGATGAGAATAAGG - Intergenic
1012996560 6:105981389-105981411 GCATAAGAACGATGAGAACCAGG + Intergenic
1013879953 6:114885439-114885461 GACAAAGTTTAATGAGAAACTGG + Intergenic
1014638163 6:123874671-123874693 GCAAAAATATTATGTGAAAAAGG + Intronic
1014704496 6:124729121-124729143 CCAGAAGTATGAGGAGGAACTGG + Intronic
1015309448 6:131750316-131750338 GTAAAAATTTAATGAGAAACAGG - Intergenic
1015752655 6:136575934-136575956 GCAAAAGAATGAGGAGAAACAGG - Intronic
1016658929 6:146553275-146553297 GGAAAAGTGCGGTGAGAAACAGG + Intronic
1016892956 6:149024564-149024586 GCTAAAATATATTGAGAAACTGG - Intronic
1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG + Intronic
1018416543 6:163606699-163606721 GCAAAAGGATGAAGAGAGAGTGG - Intergenic
1019758730 7:2792847-2792869 GCAAAAGCCTGAGGAGAAACAGG + Intronic
1019763200 7:2829676-2829698 ACAAAAGTCAGATGAAAAACAGG - Intronic
1019902568 7:4033902-4033924 GGAGAAGTTTGATGAGGAACAGG + Intronic
1020712413 7:11624300-11624322 GCAAAATTATGTTCATAAACAGG - Intronic
1022793725 7:33714944-33714966 GCAAAAGGAGGAGGAGAAAGAGG - Intergenic
1023276466 7:38523842-38523864 GTGACAGTTTGATGAGAAACAGG + Intronic
1023618850 7:42049249-42049271 GCAAAAGTCTGCTTAGAAATGGG + Intronic
1024469197 7:49749520-49749542 TTAAAAGTATGAGAAGAAACAGG + Intergenic
1025579050 7:62687475-62687497 GAAAAAGCTTAATGAGAAACTGG + Intergenic
1026437107 7:70408598-70408620 GCAAAAGTGTGATGATTATCAGG - Intronic
1026482184 7:70789072-70789094 GCCAAAGTCTGATGAGAAGACGG - Intronic
1027820516 7:83037155-83037177 GCTATAGTATGATCACAAACTGG - Intronic
1028407615 7:90493241-90493263 GCAAAATCTGGATGAGAAACAGG + Intronic
1028525373 7:91778989-91779011 GCAAATGTATGATGAGAAACAGG + Intronic
1029233319 7:99090091-99090113 GGAAAGGGATGGTGAGAAACAGG + Intronic
1029578896 7:101421814-101421836 ATGATAGTATGATGAGAAACAGG - Intronic
1030299156 7:107957798-107957820 AAAAAAGAATGATGAGAAACTGG + Intronic
1030428067 7:109405766-109405788 GCAAAACTATGATGAGATGAAGG - Intergenic
1030638295 7:111974766-111974788 GCAAAAGTAAGATAATAACCCGG - Intronic
1031367973 7:120926649-120926671 GTAAAAATGTGATGAGGAACAGG - Intergenic
1031597602 7:123666019-123666041 GCAAAAGTTTGCTGATAAACTGG + Intergenic
1031611450 7:123832591-123832613 GCAGAAGAATGATGTGAACCCGG - Intronic
1032033684 7:128505628-128505650 GTAGAAGTTTGATGAGGAACAGG - Intronic
1032484523 7:132275079-132275101 GCAACAGTTTGAGGAGAAACTGG - Intronic
1033398211 7:140995601-140995623 GCAAAAGTTTAAGGAGAAGCAGG - Intergenic
1033793190 7:144816996-144817018 GCAAAAGTTTGAGAAGAAACAGG + Intronic
1033995987 7:147348502-147348524 TCACAAGTATGAAGAGAAAAGGG + Intronic
1034153782 7:148937699-148937721 GCAAAAGAATGGTGTGAACCCGG + Intergenic
1034160511 7:148990933-148990955 GCAGAAGAATGATGTGAACCTGG + Intergenic
1034850376 7:154487881-154487903 GCAAAAGATTGATGAGTCACAGG - Intronic
1035190208 7:157160714-157160736 GCAAAAGTTTGAGGAGAAACAGG - Intronic
1036082996 8:5578515-5578537 GTGAAAGTAAGATGAGAAACAGG + Intergenic
1036974202 8:13392017-13392039 GCAAAATTAAGATAAGAAAATGG - Intronic
1038738527 8:30195042-30195064 GAAAAAGTCTGATGGAAAACAGG + Intergenic
1038926688 8:32148490-32148512 GCAGGAGTATGGTGTGAAACTGG - Intronic
1039525575 8:38212810-38212832 GCAAAAGTTTAAGCAGAAACGGG - Exonic
1039562209 8:38521578-38521600 TTAAAAGTTTGATGAGAAACAGG - Intronic
1039929555 8:41972340-41972362 ATAAAAGTTTGATGAAAAACAGG + Intronic
1039968180 8:42299002-42299024 GGAACAATATGGTGAGAAACAGG - Intronic
1040038075 8:42890369-42890391 GCAAGAGAATGACGAGAACCCGG - Intronic
1041215096 8:55592621-55592643 GCAGAAGAATGATGTGAACCTGG - Intergenic
1042289849 8:67158548-67158570 GCAGGAGTATGAAGAGGAACAGG + Exonic
1042389956 8:68222639-68222661 GTGAAAGTTTGAAGAGAAACAGG + Intronic
1043643842 8:82491572-82491594 GTGAAAGTATGAGGAGAATCAGG - Intergenic
1044012335 8:87009941-87009963 ACAAAAGAAGGATGAGGAACAGG - Intronic
1044629778 8:94267021-94267043 GCAGGAGTCTGATGAGAAGCTGG - Intergenic
1045453924 8:102356961-102356983 GCAAAAGTATGATGAGGAAGAGG + Intronic
1045702079 8:104878941-104878963 GTAATAGTATGTTGATAAACAGG + Intronic
1045893694 8:107188146-107188168 ACAGAAATCTGATGAGAAACTGG - Intergenic
1046915744 8:119676396-119676418 CCTAAAGTATGAGTAGAAACTGG - Intergenic
1047621703 8:126614214-126614236 GCAAATGTATGACGAGAAACAGG - Intergenic
1048517586 8:135124765-135124787 GCAAGAGAATGATGTGAACCCGG - Intergenic
1052308894 9:27042586-27042608 TTAAAAGCAAGATGAGAAACTGG + Intronic
1052394951 9:27927675-27927697 GCAAAAGTGTGAGAAGAAAAAGG + Intergenic
1052869250 9:33487168-33487190 CCAAAAGTTTGAGAAGAAACAGG + Intergenic
1053039899 9:34861785-34861807 GTGAAAGTTTGATGAGGAACAGG + Intergenic
1053363587 9:37507174-37507196 GTGAAAGTTTGATGAGGAACAGG - Intergenic
1053828851 9:42053987-42054009 ACAAAGGTTTGATGAGAAAGTGG + Intronic
1054601707 9:67133467-67133489 ACAAAGGTTTGATGAGAAAGTGG - Intergenic
1055240666 9:74182644-74182666 GCAAAAGCATGACTAGAAGCAGG - Intergenic
1056110135 9:83387122-83387144 GCAAAAGTTTAAGGAGAAACAGG - Intronic
1056147493 9:83747372-83747394 GCAAAAGTATGAAGAGCAGTGGG + Intronic
1056466188 9:86857714-86857736 CCAAAAGATTGATCAGAAACTGG + Intergenic
1056466394 9:86859933-86859955 CCAAAAGATTGATCAGAAACTGG + Intergenic
1056885955 9:90444017-90444039 CCAAACATATGCTGAGAAACTGG - Intergenic
1057012330 9:91615950-91615972 GTACAAGTTTGAGGAGAAACTGG + Intronic
1057060113 9:91996335-91996357 GGAAAAGTTTGAGGAGAAACAGG - Intergenic
1057494458 9:95549795-95549817 GAAAAGGTATGATAAGAAAATGG - Intergenic
1057689155 9:97267889-97267911 CCAAAAGTTTGAGAAGAAACAGG - Intergenic
1058005400 9:99908284-99908306 GGGAAAGTCTGAGGAGAAACAGG - Intronic
1058448870 9:105077909-105077931 GCAAAAGTAGTCTGAGAAGCAGG + Intergenic
1058667685 9:107335710-107335732 GCCAAACTTTGATGAGAAATAGG - Intergenic
1060438452 9:123616540-123616562 ACAAAAGTATGAAAAGAAATAGG + Intronic
1061977086 9:134074586-134074608 GGAAAATTCTGGTGAGAAACAGG + Intergenic
1187027300 X:15448873-15448895 GCAGAAGTATAATGTGACACAGG - Intronic
1187443598 X:19341792-19341814 GTAAATGTATGATGAGAAACAGG - Intergenic
1187609884 X:20931118-20931140 GCAATTCTATGTTGAGAAACTGG - Intergenic
1187689777 X:21854667-21854689 GGAAAAGTATAAGAAGAAACAGG + Intronic
1188387086 X:29574743-29574765 GCAAAGGGATGATCTGAAACTGG - Intronic
1188572467 X:31604578-31604600 GGAAAAATATGCTGAGGAACAGG - Intronic
1188720984 X:33523379-33523401 ATAAAATAATGATGAGAAACAGG + Intergenic
1188741986 X:33795603-33795625 GCAAATCAATGAAGAGAAACAGG - Intergenic
1188796879 X:34478086-34478108 GTAAATGTATGATGAAAAGCTGG - Intergenic
1188809882 X:34640397-34640419 GAAATAGTATGATGAAAAACTGG + Intronic
1189948065 X:46200569-46200591 GGGAAAGTTTGAGGAGAAACAGG + Intergenic
1190107897 X:47572426-47572448 GGAAAATTATGATGGGAAATAGG + Exonic
1190124121 X:47688172-47688194 GCAAAAGTTTGAATAGAAACAGG - Intergenic
1190982165 X:55465834-55465856 GCAGAAGTAGGATCTGAAACTGG + Intergenic
1190986533 X:55507348-55507370 GCAGAAGTAGGATCTGAAACTGG - Intergenic
1191695243 X:63983410-63983432 GCAAGAGTATGCTGAAAAATTGG + Intergenic
1193104740 X:77657755-77657777 GCTTAAGTATGATAAGAAACAGG + Intronic
1193332876 X:80255638-80255660 GCAAAAAGATGATCTGAAACTGG + Intergenic
1193660848 X:84256295-84256317 ACAAAAGTATTATGAAAATCAGG + Intergenic
1194206359 X:91015875-91015897 GCAAAGCAATGATGAAAAACTGG - Intergenic
1195083653 X:101393928-101393950 ACTAATGTAAGATGAGAAACTGG + Intronic
1195779336 X:108443822-108443844 GCAAATATATGATGAGAAACAGG - Intronic
1196034549 X:111129949-111129971 GTAAAAGTCTGAGGAGAAAAAGG - Intronic
1196099900 X:111837124-111837146 TCAAAAGTAAGATGAGAGTCTGG + Intronic
1196172073 X:112600037-112600059 GCAAAAGTTTAAGGAGAAACAGG + Intergenic
1196231450 X:113227452-113227474 GCAAAATTATGATCAGGAATTGG + Intergenic
1196345933 X:114658850-114658872 GCAAAAGTTTTAGGATAAACAGG + Intronic
1196527605 X:116744852-116744874 GCAGAAGAATGATGTGAACCCGG + Intergenic
1196775055 X:119330953-119330975 GGCAAAGTATGATGAGAAACAGG - Intergenic
1196851865 X:119945642-119945664 GCAGAAGGATGAAGAGAAATAGG - Intergenic
1197136345 X:123064823-123064845 AAAAAAGAATGATGAAAAACTGG - Intergenic
1198000572 X:132431164-132431186 GTAAAAGTTGGAGGAGAAACAGG - Intronic
1198522541 X:137467662-137467684 GTGAAAGTTTGATGAGAAATGGG - Intergenic
1198998493 X:142604773-142604795 GCAAAACTCTGATGAAAAAGAGG + Intergenic
1199015884 X:142814497-142814519 AAAAAAGTTTGAGGAGAAACAGG - Intergenic
1199445710 X:147918212-147918234 GAAAAACTATGATGAGAAACAGG + Intronic
1199588635 X:149443345-149443367 ATAAAAGCATGATGAAAAACAGG + Intergenic
1199830434 X:151544400-151544422 TTAAAAGTAGGATGAAAAACAGG - Intergenic
1200552111 Y:4590696-4590718 GCAAAGCAATGATGAAAAACTGG - Intergenic
1201246152 Y:12005684-12005706 GCAAGAATATGATGAGGAAGTGG + Intergenic
1201345435 Y:12978877-12978899 GCAAAAAAATAATTAGAAACGGG + Intergenic