ID: 941329794

View in Genome Browser
Species Human (GRCh38)
Location 2:164165670-164165692
Sequence GCCACCGACTCAAGGTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941329787_941329794 15 Left 941329787 2:164165632-164165654 CCTTGTCTTTTCTGCCTGTACAT No data
Right 941329794 2:164165670-164165692 GCCACCGACTCAAGGTCACAGGG No data
941329786_941329794 25 Left 941329786 2:164165622-164165644 CCATGTGTGACCTTGTCTTTTCT No data
Right 941329794 2:164165670-164165692 GCCACCGACTCAAGGTCACAGGG No data
941329789_941329794 1 Left 941329789 2:164165646-164165668 CCTGTACATCTTGCCTGGTACCT No data
Right 941329794 2:164165670-164165692 GCCACCGACTCAAGGTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941329794 Original CRISPR GCCACCGACTCAAGGTCACA GGG Intergenic
No off target data available for this crispr