ID: 941330667

View in Genome Browser
Species Human (GRCh38)
Location 2:164174556-164174578
Sequence GACAGCTCTTTGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941330667_941330671 15 Left 941330667 2:164174556-164174578 CCAGTAACAGGCAAAGAGCTGTC No data
Right 941330671 2:164174594-164174616 ACTTATCTGACAAAGATGGCAGG No data
941330667_941330670 11 Left 941330667 2:164174556-164174578 CCAGTAACAGGCAAAGAGCTGTC No data
Right 941330670 2:164174590-164174612 GAGCACTTATCTGACAAAGATGG No data
941330667_941330672 16 Left 941330667 2:164174556-164174578 CCAGTAACAGGCAAAGAGCTGTC No data
Right 941330672 2:164174595-164174617 CTTATCTGACAAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941330667 Original CRISPR GACAGCTCTTTGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr