ID: 941330671

View in Genome Browser
Species Human (GRCh38)
Location 2:164174594-164174616
Sequence ACTTATCTGACAAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941330665_941330671 22 Left 941330665 2:164174549-164174571 CCAAAGCCCAGTAACAGGCAAAG No data
Right 941330671 2:164174594-164174616 ACTTATCTGACAAAGATGGCAGG No data
941330666_941330671 16 Left 941330666 2:164174555-164174577 CCCAGTAACAGGCAAAGAGCTGT No data
Right 941330671 2:164174594-164174616 ACTTATCTGACAAAGATGGCAGG No data
941330667_941330671 15 Left 941330667 2:164174556-164174578 CCAGTAACAGGCAAAGAGCTGTC No data
Right 941330671 2:164174594-164174616 ACTTATCTGACAAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941330671 Original CRISPR ACTTATCTGACAAAGATGGC AGG Intergenic
No off target data available for this crispr