ID: 941341625

View in Genome Browser
Species Human (GRCh38)
Location 2:164312388-164312410
Sequence TTGTTCATTAATACGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941341622_941341625 17 Left 941341622 2:164312348-164312370 CCATTTCATTTGTAATAGTATGA No data
Right 941341625 2:164312388-164312410 TTGTTCATTAATACGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941341625 Original CRISPR TTGTTCATTAATACGGAAGT GGG Intergenic
No off target data available for this crispr