ID: 941351356

View in Genome Browser
Species Human (GRCh38)
Location 2:164441098-164441120
Sequence CATACAGGACCAGTTTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941351356_941351360 11 Left 941351356 2:164441098-164441120 CCTAGGGAAACTGGTCCTGTATG No data
Right 941351360 2:164441132-164441154 TAGCAAAGAGCAGTTCCATTGGG No data
941351356_941351361 19 Left 941351356 2:164441098-164441120 CCTAGGGAAACTGGTCCTGTATG No data
Right 941351361 2:164441140-164441162 AGCAGTTCCATTGGGACAAAAGG No data
941351356_941351359 10 Left 941351356 2:164441098-164441120 CCTAGGGAAACTGGTCCTGTATG No data
Right 941351359 2:164441131-164441153 ATAGCAAAGAGCAGTTCCATTGG No data
941351356_941351363 26 Left 941351356 2:164441098-164441120 CCTAGGGAAACTGGTCCTGTATG No data
Right 941351363 2:164441147-164441169 CCATTGGGACAAAAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941351356 Original CRISPR CATACAGGACCAGTTTCCCT AGG (reversed) Intergenic
No off target data available for this crispr