ID: 941351358

View in Genome Browser
Species Human (GRCh38)
Location 2:164441113-164441135
Sequence GCTATGCCTTGTTGTCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941351358_941351359 -5 Left 941351358 2:164441113-164441135 CCTGTATGACAACAAGGCATAGC No data
Right 941351359 2:164441131-164441153 ATAGCAAAGAGCAGTTCCATTGG No data
941351358_941351363 11 Left 941351358 2:164441113-164441135 CCTGTATGACAACAAGGCATAGC No data
Right 941351363 2:164441147-164441169 CCATTGGGACAAAAGGAACAAGG No data
941351358_941351360 -4 Left 941351358 2:164441113-164441135 CCTGTATGACAACAAGGCATAGC No data
Right 941351360 2:164441132-164441154 TAGCAAAGAGCAGTTCCATTGGG No data
941351358_941351361 4 Left 941351358 2:164441113-164441135 CCTGTATGACAACAAGGCATAGC No data
Right 941351361 2:164441140-164441162 AGCAGTTCCATTGGGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941351358 Original CRISPR GCTATGCCTTGTTGTCATAC AGG (reversed) Intergenic
No off target data available for this crispr