ID: 941351363

View in Genome Browser
Species Human (GRCh38)
Location 2:164441147-164441169
Sequence CCATTGGGACAAAAGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941351356_941351363 26 Left 941351356 2:164441098-164441120 CCTAGGGAAACTGGTCCTGTATG No data
Right 941351363 2:164441147-164441169 CCATTGGGACAAAAGGAACAAGG No data
941351358_941351363 11 Left 941351358 2:164441113-164441135 CCTGTATGACAACAAGGCATAGC No data
Right 941351363 2:164441147-164441169 CCATTGGGACAAAAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941351363 Original CRISPR CCATTGGGACAAAAGGAACA AGG Intergenic
No off target data available for this crispr