ID: 941352794

View in Genome Browser
Species Human (GRCh38)
Location 2:164456798-164456820
Sequence CATTGTGCCCAGATGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941352792_941352794 20 Left 941352792 2:164456755-164456777 CCAGCTGTTTCTGTGGCAAGTTC No data
Right 941352794 2:164456798-164456820 CATTGTGCCCAGATGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941352794 Original CRISPR CATTGTGCCCAGATGCAGCC TGG Intergenic
No off target data available for this crispr