ID: 941352794 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:164456798-164456820 |
| Sequence | CATTGTGCCCAGATGCAGCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941352792_941352794 | 20 | Left | 941352792 | 2:164456755-164456777 | CCAGCTGTTTCTGTGGCAAGTTC | No data | ||
| Right | 941352794 | 2:164456798-164456820 | CATTGTGCCCAGATGCAGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941352794 | Original CRISPR | CATTGTGCCCAGATGCAGCC TGG | Intergenic | ||
| No off target data available for this crispr | |||||