ID: 941356125

View in Genome Browser
Species Human (GRCh38)
Location 2:164494605-164494627
Sequence GTGTATGCATAAATGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941356125 Original CRISPR GTGTATGCATAAATGTAGCT GGG Intronic
902913705 1:19622184-19622206 GTGTATACATATACGTAGCAGGG + Intronic
909107164 1:71426043-71426065 ATGTATGCATATATGTATGTAGG - Intronic
909341384 1:74535353-74535375 GTGTCAGCATAAGAGTAGCTGGG - Intronic
910502304 1:87906722-87906744 GTGTGTACATATATGTAGGTAGG - Intergenic
918485026 1:185019671-185019693 TTGGATGAATAAATGTAGCAGGG + Intergenic
918532530 1:185539009-185539031 GTGTATACATATATGTATATCGG - Intergenic
918658149 1:187054437-187054459 ATTTATGCATATCTGTAGCTTGG - Intergenic
919667320 1:200304450-200304472 GTGTATTAATAAATCTTGCTTGG - Intergenic
922915625 1:229255160-229255182 GCTTTTGAATAAATGTAGCTAGG - Intergenic
924551752 1:245084493-245084515 GTGTATGCATATATGTATGATGG - Intronic
1064096143 10:12425892-12425914 GTGCATGCAAAAATGTTCCTGGG - Intronic
1067360818 10:45576574-45576596 GTGTATACATAGATGTTGCTAGG + Intronic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1070268269 10:74926027-74926049 GTCTATGCATTTATGTAGGTAGG - Intronic
1071770190 10:88720700-88720722 GTGTGTGCATAAAACTTGCTTGG - Intergenic
1072327736 10:94314688-94314710 GTGTATGATGAAATGTAGCTGGG + Intronic
1072408604 10:95178783-95178805 GTGTATTTATAAAGGTATCTAGG - Intergenic
1074436647 10:113440066-113440088 GTAAATGGATAAATGTGGCTTGG - Intergenic
1076595320 10:131621522-131621544 GTGTATGCATATATGTGGACAGG + Intergenic
1079462844 11:20699326-20699348 GTGTATACATATATATACCTTGG - Intronic
1079676794 11:23238300-23238322 GAATATGGATAAAAGTAGCTAGG + Intergenic
1081103746 11:39038107-39038129 TTGTTATCATAAATGTAGCTAGG + Intergenic
1085814355 11:79720710-79720732 CTGGATGCATAAATGCAGATTGG - Intergenic
1085978506 11:81692599-81692621 TTTTTTGCAGAAATGTAGCTGGG + Intergenic
1086098990 11:83079300-83079322 GTGTATGGATAAACATAGCTGGG - Intergenic
1087222783 11:95564509-95564531 GTTTAGGCACAAATGAAGCTGGG + Intergenic
1088207804 11:107414351-107414373 GTATATGAATAACTCTAGCTGGG - Intronic
1093625492 12:21341927-21341949 GTGTATGTATAAATGAGGCATGG + Intronic
1098475286 12:70894365-70894387 TTGTATGCATAAATGAACGTGGG - Intronic
1099139463 12:78953452-78953474 GTGTATACATAAATGCACTTCGG - Intronic
1101381768 12:104219527-104219549 GTGTAATCATAAAAGTAGATGGG + Intronic
1101554164 12:105791841-105791863 GTGTCTGCATGTGTGTAGCTGGG + Intergenic
1101739274 12:107487709-107487731 GTGTGTGCAAAAATATAGTTGGG - Intronic
1102817358 12:115878015-115878037 CTGAATGAATAAATGTAACTTGG - Intergenic
1103586189 12:121957978-121958000 GTGTATGCAAATATGGAGTTTGG - Intronic
1106455883 13:29926211-29926233 GTGTATGCATTAATGTGTGTGGG - Intergenic
1108302978 13:49098999-49099021 TTATATGAATAAATGTTGCTAGG + Intronic
1113913830 13:113858218-113858240 GTGTCTGCATGCATGTGGCTGGG + Intronic
1115306506 14:31939072-31939094 GTGTATGCATAAATGGTGGATGG - Intergenic
1116427026 14:44803580-44803602 ATATATGCATAAATCTACCTAGG - Intergenic
1118935507 14:70284287-70284309 GTGTACACATAAATGTAGCCAGG - Intergenic
1121809917 14:96875929-96875951 GTGTGTGTATAAATGTATATAGG - Intronic
1122848155 14:104512087-104512109 GAGTATGCAGACATGTGGCTCGG + Intronic
1125067405 15:35505027-35505049 ATGTAGGAATTAATGTAGCTGGG - Intronic
1125313367 15:38404586-38404608 GTCTGTGCATAAATGTATCCTGG + Intergenic
1128791146 15:70434818-70434840 GTGCCTCCATAAATGTAGCCTGG + Intergenic
1131998046 15:98151833-98151855 GTGTGTGTATAAATGAAGCTGGG + Intergenic
1132078056 15:98839413-98839435 GTGTGAGCATATATGTGGCTGGG - Intronic
1133107567 16:3522811-3522833 TTCTATGCATAAATATAGATAGG - Intronic
1134145111 16:11754594-11754616 ATTTAAGAATAAATGTAGCTGGG + Intronic
1137525011 16:49227661-49227683 GTTCTTGCATAAATGAAGCTGGG - Intergenic
1137970213 16:52977218-52977240 ATGGATGCATAAATTTTGCTTGG + Intergenic
1138919142 16:61505329-61505351 GTGTATGCATGAAGGTAGGCAGG - Intergenic
1142209147 16:88799663-88799685 GTGCAGGCATGAATGTAGCTTGG - Intergenic
1146043619 17:29482800-29482822 GTATATGCATCACTGTAGCAGGG + Intronic
1151377005 17:73695956-73695978 GTGTATGCATGAGTGTATCATGG - Intergenic
1158501441 18:58005722-58005744 GTGTAGGCATATATCTTGCTTGG + Intergenic
1167598418 19:50439461-50439483 GTGAATGCATGGATGGAGCTTGG - Intronic
1168548043 19:57270117-57270139 GTGTGTTCAAAAATGTACCTGGG - Intergenic
929131870 2:38583293-38583315 GTGTATGCATAGAAGAAGGTAGG - Intronic
930214943 2:48685215-48685237 GAGTATGCGTACAAGTAGCTTGG + Intronic
933242297 2:79935672-79935694 ATGAATGCATAAATCTAACTGGG + Intronic
933988462 2:87614411-87614433 ATGTTTGCATAAATGTTGCAGGG + Intergenic
935252585 2:101277330-101277352 GTGTTTGCATAGTTGAAGCTCGG - Intronic
936305378 2:111336400-111336422 ATGTTTGCATAAATGTTGCAGGG - Intergenic
936574683 2:113643052-113643074 GTGTATTCCTAACTATAGCTAGG - Exonic
939784059 2:146486489-146486511 GTCTTTGTATAAATGTAGTTTGG - Intergenic
941356125 2:164494605-164494627 GTGTATGCATAAATGTAGCTGGG + Intronic
944620357 2:201508157-201508179 GTTTAAGAATAAATGTATCTGGG + Intronic
1169676587 20:8161269-8161291 ATGTATGTATATATGTAGCACGG - Intronic
1170802177 20:19599638-19599660 GGGCATGCATAAACGTAGCTCGG - Intronic
1177630847 21:23725431-23725453 GTGTATGCATAAACCTGGCAAGG + Intergenic
1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG + Intronic
1178575788 21:33788803-33788825 GAGAATGAATAAATGTAGCCTGG + Intronic
1179623794 21:42635956-42635978 ATGAATGTATATATGTAGCTTGG - Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
1185425491 22:50767824-50767846 GTGTATTCCTAACTATAGCTAGG + Exonic
949778806 3:7662844-7662866 GTATATGCTTACATGTATCTAGG + Intronic
951382283 3:21998207-21998229 GGGTAGGTATAAATGTAGCCAGG + Intronic
951963844 3:28360124-28360146 ATGTATACATTAATGTAGCTTGG + Intronic
952735650 3:36689352-36689374 GTGTTTGCAAAGATGTAGATAGG - Intergenic
953672935 3:44977665-44977687 GTGTATACAAAAATATAGCAGGG - Intronic
954558320 3:51535730-51535752 GTGTATGCATAAATCACTCTAGG + Intergenic
955622797 3:60883621-60883643 GTCTATTCATAAATGATGCTGGG + Intronic
956516722 3:70057619-70057641 GTATATGCATATGTATAGCTTGG - Intergenic
957988881 3:87606384-87606406 TTGTATGCATATATGTTTCTGGG + Intergenic
959434052 3:106291284-106291306 ATGTATGCATATATGCAGCAAGG - Intergenic
961835193 3:129652239-129652261 GTGTATGCATATATGTGTCAAGG + Intronic
964098496 3:152962096-152962118 GTGTATACATACATGTACATAGG + Intergenic
965680793 3:171249321-171249343 ATGTATGCCTAAAGGTACCTGGG - Intronic
965817498 3:172652233-172652255 GTGAAAGCATAAATGTAGCAGGG + Intronic
965967487 3:174511663-174511685 GTGTAGGCTTAAATCTATCTTGG + Intronic
966211854 3:177461601-177461623 GTGTATACTTAAATGTACATAGG - Intergenic
967240775 3:187437320-187437342 GTGTATGCATATGTGTGGTTGGG - Intergenic
967402806 3:189082835-189082857 GTGCATGAGTAAATGTAGCAGGG - Intronic
969466417 4:7359725-7359747 CTGTAGGCATTAATGTAGCTGGG + Intronic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
970359737 4:15296998-15297020 GTCAAAGCATAATTGTAGCTGGG + Intergenic
972617150 4:40710265-40710287 ATGAATGGATAAATGTACCTTGG - Intergenic
974175243 4:58314285-58314307 GTGTATACATGAATGTGGCAAGG + Intergenic
975519515 4:75284959-75284981 GTTTATGCATAGATGTATATAGG + Intergenic
975920108 4:79376030-79376052 ATGTATGTATAAATGTATGTAGG + Intergenic
979284888 4:118911554-118911576 GTGCATGCATAAAAGTTTCTTGG + Intronic
980445793 4:132906043-132906065 GTGTATGTATAAATATATATGGG + Intergenic
981160579 4:141493942-141493964 CTTTATGCATCAATGTGGCTTGG + Intergenic
981830122 4:148989919-148989941 GTGTAAGCAAGAAAGTAGCTTGG + Intergenic
985424419 4:189814884-189814906 GTGAATGGATAAAAGTAGTTTGG + Intergenic
986998729 5:13637283-13637305 GTGTATGCATATAGGTGTCTAGG + Intergenic
987036104 5:14019926-14019948 ATGTATGCATACATGTATGTGGG + Intergenic
987966371 5:24881538-24881560 GTGTATGTATATATGTATTTTGG + Intergenic
990722963 5:58718772-58718794 GAATATGCATAAATGAAGCCAGG + Intronic
991749742 5:69788162-69788184 GTGAATGAATAACTGTATCTAGG + Intergenic
991763368 5:69946480-69946502 GTGAATGAATAACTGTATCTAGG - Intergenic
991783959 5:70171651-70171673 GTGAATGAATAACTGTATCTAGG + Intergenic
991801319 5:70367976-70367998 GTGAATGAATAACTGTATCTAGG + Intergenic
991827278 5:70642066-70642088 GTGAATGAATAACTGTATCTAGG - Intergenic
991842597 5:70821538-70821560 GTGAATGAATAACTGTATCTAGG - Intergenic
991876404 5:71172026-71172048 GTGAATGAATAACTGTATCTAGG + Intergenic
993719084 5:91304321-91304343 GTGTATACAGAAAGTTAGCTTGG - Intergenic
993799544 5:92315461-92315483 ATGTATACATAAATCTAGGTAGG - Intergenic
994491663 5:100453793-100453815 GTGTGTGCATACATGCAGCAGGG - Intergenic
996035044 5:118749541-118749563 GAGTATGCAAAAATCTAGCCAGG - Intergenic
998663936 5:144274306-144274328 GTGTAGGAATAAAGGTAGCTTGG + Intronic
998682299 5:144482491-144482513 GTTTATGCATGAGTGTATCTAGG + Exonic
998989560 5:147800970-147800992 GTGCATGCCTAAATGAACCTGGG + Intergenic
999032974 5:148314938-148314960 GTTTTTGCAGAAATGTAGCTAGG + Intronic
999894577 5:156016674-156016696 GTGTTTACTTAAATGTAACTTGG + Intronic
1000546373 5:162608758-162608780 CAGTCTACATAAATGTAGCTTGG + Intergenic
1005565612 6:27090545-27090567 GTTCATGCATAGATGGAGCTGGG - Intergenic
1006972738 6:38063489-38063511 GTGTATGCAAACATGTATCAGGG - Intronic
1008326605 6:50189458-50189480 GTGGAAGCACAAAAGTAGCTAGG + Intergenic
1009320617 6:62284178-62284200 TTGTATGCATTTATTTAGCTTGG + Intronic
1009606473 6:65875446-65875468 GTGTATGCATTAATTTAGTATGG + Intergenic
1009941868 6:70299695-70299717 GGGTAAGCATAAATTTAACTAGG - Intronic
1013471165 6:110467645-110467667 GTGTATCCAAAAATTTAGCCTGG + Intronic
1014795133 6:125716229-125716251 GTGTAAGCAAAAATGAAGCCAGG + Intergenic
1015506287 6:133992272-133992294 GTGTGGGCATAGATGTAGGTAGG + Intronic
1016926432 6:149353960-149353982 TTTTATGCATAAATATAACTTGG - Intronic
1019110770 6:169711228-169711250 GTGTATGCATATGTGTATTTTGG + Intronic
1020973180 7:14972894-14972916 GTGTATACATACATATAGGTGGG + Intronic
1022380610 7:29856035-29856057 ATGTATGTATATATGTAGATAGG + Intronic
1022583461 7:31581005-31581027 GTGGATGAGTAAATGAAGCTTGG + Intronic
1022931320 7:35118219-35118241 GTGTATGCATGTATGAAACTTGG + Intergenic
1023240378 7:38139728-38139750 GTGTATGAATAATTGTACTTGGG - Intergenic
1024925511 7:54609573-54609595 ATGAATTTATAAATGTAGCTTGG + Intergenic
1026423292 7:70263032-70263054 GTATTTGCATAAATGTTACTAGG + Intronic
1028678787 7:93500598-93500620 GTGTTTGCAGAAATGGAGGTGGG + Intronic
1029082106 7:97983050-97983072 GTGCATGCCTAATTGTGGCTTGG + Intergenic
1029151982 7:98486924-98486946 GTGTGTGCACACATGTATCTGGG + Intergenic
1030743711 7:113139729-113139751 GTCTATGCATAAAGGTGGCCAGG - Intergenic
1031356136 7:120789311-120789333 GTGAATGAATGAATGTGGCTGGG + Intronic
1031448289 7:121881828-121881850 GTGTCTGGATAAATGTCACTTGG - Intronic
1036418591 8:8574253-8574275 GAGAATGCCTGAATGTAGCTGGG + Intergenic
1037099854 8:15031969-15031991 GTGTATGCAAAAATGAAACTGGG - Intronic
1037632277 8:20669021-20669043 GTGTTTGCATAAATTTATATAGG + Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039419569 8:37424844-37424866 GTGTTTGCATAAGTGTAATTAGG + Intergenic
1041472173 8:58222989-58223011 GTTTTTGCATAAATGTGCCTGGG - Intergenic
1042735468 8:71983087-71983109 GTGTATATATATATATAGCTAGG + Intronic
1050456155 9:5836508-5836530 GTTTATGGGTAAATGTAGCTAGG + Intergenic
1052584103 9:30402534-30402556 GTGTATGCATTAATGTTGGAGGG - Intergenic
1054841043 9:69740179-69740201 GTGTATACATATATGTATATAGG + Intronic
1056784394 9:89579835-89579857 GTGTATGTATAAATGTGCATTGG + Intergenic
1059967445 9:119629315-119629337 GTGTGTGTATAAATGTATATGGG + Intergenic
1060900436 9:127252633-127252655 ATATGTGCATAAATGTTGCTTGG - Intronic
1062270949 9:135708261-135708283 ATGTATGCATACATGTACATGGG - Intronic
1185547676 X:958535-958557 GTGTAGGAATAAAAGCAGCTCGG + Intergenic
1187466645 X:19533343-19533365 GTGTGTGAATAAAAGTGGCTTGG + Intergenic
1187813686 X:23208249-23208271 GTGTATGCATAATTGTAGCAAGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1192185489 X:68944181-68944203 GTGTGTGAGTAACTGTAGCTGGG + Intergenic
1193842615 X:86426151-86426173 GTGTACACATAAAGTTAGCTAGG + Intronic
1194816959 X:98454376-98454398 GTGTATGTATACATGTGGTTAGG - Intergenic
1194865668 X:99062862-99062884 GTGTATACAGGAAAGTAGCTGGG + Intergenic
1198842630 X:140875311-140875333 GTGAATGGATAAATGAAGTTTGG + Intergenic
1201428102 Y:13876045-13876067 GTTTATACATATATGTAGCATGG - Intergenic