ID: 941357087

View in Genome Browser
Species Human (GRCh38)
Location 2:164507190-164507212
Sequence TACCCTGATATCTCTTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941357085_941357087 21 Left 941357085 2:164507146-164507168 CCTGGTATGATAATGATTCTGAT No data
Right 941357087 2:164507190-164507212 TACCCTGATATCTCTTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941357087 Original CRISPR TACCCTGATATCTCTTAAGT TGG Intronic
No off target data available for this crispr