ID: 941357650

View in Genome Browser
Species Human (GRCh38)
Location 2:164512688-164512710
Sequence TTGTTGCTGTTCTTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941357650_941357656 27 Left 941357650 2:164512688-164512710 CCCACACACAAGAACAGCAACAA No data
Right 941357656 2:164512738-164512760 GAAGCTATACAAGAGCAGTTGGG No data
941357650_941357653 -3 Left 941357650 2:164512688-164512710 CCCACACACAAGAACAGCAACAA No data
Right 941357653 2:164512708-164512730 CAAAAGAAAACTGTGTATGAGGG No data
941357650_941357658 29 Left 941357650 2:164512688-164512710 CCCACACACAAGAACAGCAACAA No data
Right 941357658 2:164512740-164512762 AGCTATACAAGAGCAGTTGGGGG No data
941357650_941357652 -4 Left 941357650 2:164512688-164512710 CCCACACACAAGAACAGCAACAA No data
Right 941357652 2:164512707-164512729 ACAAAAGAAAACTGTGTATGAGG No data
941357650_941357657 28 Left 941357650 2:164512688-164512710 CCCACACACAAGAACAGCAACAA No data
Right 941357657 2:164512739-164512761 AAGCTATACAAGAGCAGTTGGGG No data
941357650_941357655 26 Left 941357650 2:164512688-164512710 CCCACACACAAGAACAGCAACAA No data
Right 941357655 2:164512737-164512759 GGAAGCTATACAAGAGCAGTTGG No data
941357650_941357654 5 Left 941357650 2:164512688-164512710 CCCACACACAAGAACAGCAACAA No data
Right 941357654 2:164512716-164512738 AACTGTGTATGAGGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941357650 Original CRISPR TTGTTGCTGTTCTTGTGTGT GGG (reversed) Intronic
No off target data available for this crispr