ID: 941357654

View in Genome Browser
Species Human (GRCh38)
Location 2:164512716-164512738
Sequence AACTGTGTATGAGGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941357651_941357654 4 Left 941357651 2:164512689-164512711 CCACACACAAGAACAGCAACAAA No data
Right 941357654 2:164512716-164512738 AACTGTGTATGAGGGAAAGAAGG No data
941357650_941357654 5 Left 941357650 2:164512688-164512710 CCCACACACAAGAACAGCAACAA No data
Right 941357654 2:164512716-164512738 AACTGTGTATGAGGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941357654 Original CRISPR AACTGTGTATGAGGGAAAGA AGG Intronic
No off target data available for this crispr