ID: 941359589

View in Genome Browser
Species Human (GRCh38)
Location 2:164535435-164535457
Sequence ATCTACTGCCAAGTACAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941359587_941359589 2 Left 941359587 2:164535410-164535432 CCTTCTGCCTGGATTTCTTTGCT No data
Right 941359589 2:164535435-164535457 ATCTACTGCCAAGTACAGCGTGG No data
941359584_941359589 29 Left 941359584 2:164535383-164535405 CCAAGAATGGAGAGTGCTCACCT No data
Right 941359589 2:164535435-164535457 ATCTACTGCCAAGTACAGCGTGG No data
941359588_941359589 -5 Left 941359588 2:164535417-164535439 CCTGGATTTCTTTGCTGAATCTA No data
Right 941359589 2:164535435-164535457 ATCTACTGCCAAGTACAGCGTGG No data
941359586_941359589 9 Left 941359586 2:164535403-164535425 CCTGTGACCTTCTGCCTGGATTT No data
Right 941359589 2:164535435-164535457 ATCTACTGCCAAGTACAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941359589 Original CRISPR ATCTACTGCCAAGTACAGCG TGG Intronic