ID: 941360603

View in Genome Browser
Species Human (GRCh38)
Location 2:164546803-164546825
Sequence GGGTTGCAGAGCAGAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941360603_941360610 30 Left 941360603 2:164546803-164546825 CCAGAAACTCTGCTCTGCAACCC No data
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data
941360603_941360608 5 Left 941360603 2:164546803-164546825 CCAGAAACTCTGCTCTGCAACCC No data
Right 941360608 2:164546831-164546853 AAGGAGACACCAAATCAGAGTGG 0: 11
1: 21
2: 56
3: 92
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941360603 Original CRISPR GGGTTGCAGAGCAGAGTTTC TGG (reversed) Intronic
No off target data available for this crispr