ID: 941360605

View in Genome Browser
Species Human (GRCh38)
Location 2:164546823-164546845
Sequence ATTTGGTGTCTCCTTTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941360605_941360611 13 Left 941360605 2:164546823-164546845 CCCAGCCAAAGGAGACACCAAAT No data
Right 941360611 2:164546859-164546881 CAGCAGCACCACACGATAGGAGG No data
941360605_941360613 26 Left 941360605 2:164546823-164546845 CCCAGCCAAAGGAGACACCAAAT No data
Right 941360613 2:164546872-164546894 CGATAGGAGGTTCATCCCACAGG No data
941360605_941360610 10 Left 941360605 2:164546823-164546845 CCCAGCCAAAGGAGACACCAAAT No data
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941360605 Original CRISPR ATTTGGTGTCTCCTTTGGCT GGG (reversed) Intronic
No off target data available for this crispr