ID: 941360606

View in Genome Browser
Species Human (GRCh38)
Location 2:164546824-164546846
Sequence GATTTGGTGTCTCCTTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941360606_941360610 9 Left 941360606 2:164546824-164546846 CCAGCCAAAGGAGACACCAAATC No data
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data
941360606_941360611 12 Left 941360606 2:164546824-164546846 CCAGCCAAAGGAGACACCAAATC No data
Right 941360611 2:164546859-164546881 CAGCAGCACCACACGATAGGAGG No data
941360606_941360613 25 Left 941360606 2:164546824-164546846 CCAGCCAAAGGAGACACCAAATC No data
Right 941360613 2:164546872-164546894 CGATAGGAGGTTCATCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941360606 Original CRISPR GATTTGGTGTCTCCTTTGGC TGG (reversed) Intronic
No off target data available for this crispr