ID: 941360607

View in Genome Browser
Species Human (GRCh38)
Location 2:164546828-164546850
Sequence CTCTGATTTGGTGTCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 11, 1: 26, 2: 68, 3: 88, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941360607_941360610 5 Left 941360607 2:164546828-164546850 CCAAAGGAGACACCAAATCAGAG 0: 11
1: 26
2: 68
3: 88
4: 243
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data
941360607_941360613 21 Left 941360607 2:164546828-164546850 CCAAAGGAGACACCAAATCAGAG 0: 11
1: 26
2: 68
3: 88
4: 243
Right 941360613 2:164546872-164546894 CGATAGGAGGTTCATCCCACAGG No data
941360607_941360614 29 Left 941360607 2:164546828-164546850 CCAAAGGAGACACCAAATCAGAG 0: 11
1: 26
2: 68
3: 88
4: 243
Right 941360614 2:164546880-164546902 GGTTCATCCCACAGGTCCCCTGG No data
941360607_941360611 8 Left 941360607 2:164546828-164546850 CCAAAGGAGACACCAAATCAGAG 0: 11
1: 26
2: 68
3: 88
4: 243
Right 941360611 2:164546859-164546881 CAGCAGCACCACACGATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941360607 Original CRISPR CTCTGATTTGGTGTCTCCTT TGG (reversed) Intronic
900751645 1:4401501-4401523 CTCTGATTGGGGGTCACCATGGG + Intergenic
901422966 1:9163212-9163234 CCCTGCTTTGTTGCCTCCTTAGG - Intergenic
902536471 1:17121759-17121781 CTCTGCTTTTGTGCCGCCTTGGG + Intergenic
903570551 1:24301304-24301326 CACTGTTTTGTTGTGTCCTTGGG + Intergenic
904275293 1:29379848-29379870 CTCTGATTTGGTGTTTCCTTTGG + Intergenic
904608601 1:31712839-31712861 CTCTGATTTATTTTCTGCTTTGG - Intergenic
906018132 1:42601414-42601436 CTCTGGTTTTGCATCTCCTTTGG - Intronic
906259631 1:44377297-44377319 CTCAGAACTGGTGTGTCCTTAGG - Intergenic
907672478 1:56488582-56488604 CTCTGATTTGTGGTTACCTTTGG - Intergenic
908322700 1:62993486-62993508 CTGAGATTTGGTGTGTCCATTGG + Intergenic
909082235 1:71126608-71126630 CTCTGATTTGACATCTCCATTGG + Intergenic
909247298 1:73302521-73302543 CTCCTATTTGATGTCTACTTGGG - Intergenic
909433770 1:75616944-75616966 CTCTGATTGGGGGTTTGCTTTGG + Intergenic
909470988 1:76027875-76027897 CTCTGATTTGGCTTCTCCTTTGG - Intergenic
911093154 1:94033855-94033877 CTCAGATTTGATGTCTTCTATGG + Intronic
911209479 1:95124347-95124369 CTCTGATTTGGTTTCTCTTCTGG - Intronic
911485974 1:98505463-98505485 CTCTGATGTGGTGTCTCTTTTGG - Intergenic
911753027 1:101520599-101520621 CTCTGATTTGATGTCTCTTTTGG + Intergenic
912016283 1:105040651-105040673 TTCTGGTTTGGTGTTTCCTTTGG - Intergenic
912232075 1:107806034-107806056 CACTGACTTGGCATCTCCTTTGG + Intronic
912731346 1:112109081-112109103 CTCTTATTTGGCATCTCCTTTGG + Intergenic
913076234 1:115342669-115342691 CTCTTAAGTGGTGTGTCCTTGGG + Intergenic
913712466 1:121499383-121499405 ATCTGATTTGGCATCTCCTTTGG - Intergenic
915035096 1:152915603-152915625 GTCTGATTTGGCATCTCCTTTGG - Intergenic
915035384 1:152919208-152919230 ATCTGATTTGGCATCTCCTTTGG - Intergenic
915635243 1:157181759-157181781 CTGGGATTTGGTGACTCCTGTGG + Intergenic
915686027 1:157635680-157635702 GTATGATTTGGTGTCTTCTTGGG - Intergenic
915880374 1:159664824-159664846 CTCTGATTTGGTGTCTCCTTTGG + Intergenic
915966732 1:160315389-160315411 CTCTGATTTGGCATCTCCTTTGG - Intronic
915969339 1:160342939-160342961 CTCTTCTTTGGTGTGTCCTTGGG - Intronic
916468369 1:165094902-165094924 CTCTGATGTTGTATCTCCTTTGG - Intergenic
916607199 1:166354574-166354596 CTTTTCTTTGGTGACTCCTTTGG + Intergenic
916882796 1:169036439-169036461 CTCTGATTTGGCTTTTCCTTTGG - Intergenic
917607770 1:176652573-176652595 CTCTGATTTTGCATCTTCTTTGG + Intronic
917889851 1:179425403-179425425 CTCTCACATGGAGTCTCCTTTGG + Intronic
918229869 1:182518459-182518481 CTCTGATTTGACGTCTCCTTTGG + Intronic
919771689 1:201164934-201164956 CTCTGATTGGCAGTCTCCCTAGG + Intronic
921942197 1:220853758-220853780 CTCTGATTTAGCATCTCCTTTGG + Intergenic
922431559 1:225560033-225560055 CTTTGACTCGGTGTCTCCTTTGG - Intronic
923937658 1:238781409-238781431 TTCTGATTTGGCATCTCCTTTGG + Intergenic
1063401404 10:5749437-5749459 ATCTGGGTTGGTGACTCCTTTGG - Exonic
1064643279 10:17435451-17435473 CTGTGTTTTGGCTTCTCCTTTGG + Intronic
1065405129 10:25355894-25355916 CTCTGATTTAGTATCTCCTTTGG + Intronic
1066048061 10:31611687-31611709 CTCTGGTTTGGGGTTACCTTTGG - Intergenic
1066143712 10:32534775-32534797 CTCTGACTTGACATCTCCTTTGG + Intronic
1067348399 10:45454911-45454933 CTATGTTTTGGTCTTTCCTTGGG + Exonic
1068129677 10:52881950-52881972 CTTTGATTTGTAGTGTCCTTGGG + Intergenic
1068444228 10:57099943-57099965 CTCTGATTTATTATCTCTTTCGG + Intergenic
1068800625 10:61136359-61136381 CTCTGATGCGGTGTTTGCTTTGG - Intergenic
1069095871 10:64258971-64258993 CTCTGTTTTTGTATCTCTTTAGG + Intergenic
1069128320 10:64666543-64666565 CTCTAATTTGGCATCTCCTTTGG + Intergenic
1070584857 10:77756457-77756479 CTTTGATTTGTTGTCTCCTTTGG - Intergenic
1071947234 10:90658950-90658972 CTGTGATATGGCATCTCCTTTGG - Intergenic
1072192245 10:93085578-93085600 TTCTGATTTGCTGTCTCTGTGGG + Intergenic
1072266500 10:93733378-93733400 CTCTGTTTTGGTGCCTCCTTTGG - Intergenic
1072485209 10:95848137-95848159 CTCTGATTTGGCATCTCCTTTGG + Intronic
1072835560 10:98708057-98708079 ATGTGATTTGTTGTCTACTTGGG + Intronic
1075002808 10:118810487-118810509 CTCAGAGTTGGTGTTTCCTAGGG - Intergenic
1077930294 11:6724246-6724268 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1080093936 11:28382248-28382270 CTCTGATGTGGCGTGTCTTTGGG + Intergenic
1080716992 11:34812477-34812499 TTCTGATTTGGTGTTTCCTTTGG - Intergenic
1080923987 11:36737212-36737234 ACCTGATTTGGCATCTCCTTTGG + Intergenic
1081040290 11:38201457-38201479 TTCTGATTTGTGATCTCCTTTGG - Intergenic
1082068839 11:47922355-47922377 CTCTGCTTCTGTGTCTTCTTTGG + Intergenic
1082935431 11:58652122-58652144 CTCTGATTTGGCATCTCCTTTGG + Intronic
1082944015 11:58739337-58739359 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1083860122 11:65415908-65415930 CTCTGAGCTGATGTCTCCATGGG - Intergenic
1084204948 11:67585778-67585800 CACTGGTTTGGAGTCTCCTAAGG + Intronic
1086035958 11:82414674-82414696 GTCTGATTTGGCCTCTTCTTTGG - Intergenic
1086113349 11:83221786-83221808 CTCTGATTTGGTGTCTCCTTTGG + Intronic
1086873734 11:92070499-92070521 CTCTGATTTAGTGTCTCCTTTGG - Intergenic
1087008574 11:93492634-93492656 CTCTTCTTTGAGGTCTCCTTGGG - Intronic
1087676342 11:101166347-101166369 CTCTGATTTGGTGTCTTCTTTGG + Intergenic
1089171834 11:116517431-116517453 CTCTCTTTTGTTTTCTCCTTAGG + Intergenic
1089192680 11:116665040-116665062 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1089239778 11:117067477-117067499 CACTGATTTGCTGTCACCATAGG - Intronic
1090848753 11:130552258-130552280 ATCAGATTTGGTGTCTGCTGAGG - Intergenic
1092658969 12:10718529-10718551 CTCCAATTTCTTGTCTCCTTTGG - Intronic
1092671573 12:10867741-10867763 CCCTGATTTGGCTTCTCCTTTGG + Intronic
1092941388 12:13410437-13410459 CTCTGATTTGGCATTTCCTTTGG - Intergenic
1093142660 12:15527521-15527543 CTCTGATTTGGTGTCTCCTTTGG - Intronic
1094165566 12:27439199-27439221 CTTTTATCTGGTGTCTCCTTTGG - Intergenic
1094212022 12:27902979-27903001 CTCTGTTCTGGGTTCTCCTTGGG - Intergenic
1094227959 12:28067532-28067554 CTCTGCTGTGGTGCCTTCTTTGG - Intergenic
1095504578 12:42881192-42881214 TTATGATTTGATGTCTTCTTTGG + Intergenic
1095898986 12:47307782-47307804 CTCTGATTTGGTGTCTTGTTTGG - Intergenic
1096743555 12:53711515-53711537 CTCTTATTTGGAGTTTCCGTTGG - Intronic
1099434548 12:82627869-82627891 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1100000619 12:89830520-89830542 CTCAGATTTTGTGACTCATTAGG + Intergenic
1100361244 12:93881754-93881776 CTCTGATAAAGTGTCTCCCTTGG + Intronic
1100749478 12:97681289-97681311 CTCTGATTTGGGGATTCATTTGG - Intergenic
1100804459 12:98266772-98266794 CTCTGCTCTGGTGTCTCCTTTGG - Intergenic
1101589614 12:106114046-106114068 TTCTGATTTGGTGTTGCATTTGG - Intronic
1101792609 12:107941564-107941586 CTCTGATTTAGCATCTCCTTTGG - Intergenic
1103829943 12:123770816-123770838 CTCAGACTTGGTGTCTGCTGAGG + Intronic
1104795572 12:131514794-131514816 CTGTGGCTTGGTGTCTCCTTTGG - Intergenic
1105560790 13:21488705-21488727 CTCTGGTTTGGCCTCTGCTTTGG - Intergenic
1106984123 13:35324173-35324195 CTCACCTTTGGTGTATCCTTTGG - Intronic
1107090979 13:36479112-36479134 CTCTGATTTGGTGTTTCTTTTGG - Intergenic
1107195120 13:37642419-37642441 CTCTGATTTGGCATCTCATTTGG + Intronic
1108157841 13:47604623-47604645 CTCTGACTTGGCATCTCCTTTGG - Intergenic
1108693847 13:52885277-52885299 AGCAGACTTGGTGTCTCCTTTGG + Intergenic
1108769415 13:53680294-53680316 TTCTGACTTGGTGTTTCCTTCGG + Intergenic
1109214493 13:59572491-59572513 CTTTGATTTGGTGTCTCCTTTGG - Intergenic
1109286395 13:60413683-60413705 TTCTGATCTTGTGTCACCTTTGG + Intronic
1109362716 13:61316873-61316895 CTTTGGTTTGGTGTTTTCTTTGG + Intergenic
1111671748 13:91340025-91340047 TTCTAATTTGGCGTCTCCTTTGG + Intergenic
1112165580 13:96916604-96916626 CTCTGATTTGGTATCTCCTCTGG + Intergenic
1112921580 13:104619740-104619762 CACTGATTGGCTGTGTCCTTGGG - Intergenic
1113338609 13:109400565-109400587 CTGTGCCTTGGTGTCTCCGTTGG + Intergenic
1113652176 13:112041849-112041871 CTCTGCTTTGCTGTCTGCTATGG + Intergenic
1116402166 14:44521326-44521348 TTCTGATTTGACATCTCCTTTGG + Intergenic
1117021121 14:51571498-51571520 CTCTGATCTGGTGTAACCCTGGG + Intronic
1117618069 14:57554501-57554523 CTCTGATTTCGTATATCCTTTGG + Intergenic
1118979016 14:70701215-70701237 CTCACATTTGTTGTTTCCTTTGG - Intergenic
1122692302 14:103537153-103537175 CTCTGCTATGGGGACTCCTTCGG - Intergenic
1122843435 14:104477630-104477652 CTCTGTTTGGGTGTCTCAGTGGG - Intronic
1124349408 15:28944173-28944195 CTCTTATCTGATGTCTCTTTCGG - Intronic
1124690175 15:31815283-31815305 CTCTGATTCAGTGTCCACTTGGG - Intronic
1125365541 15:38911507-38911529 CTGTGATTTGGCATCTCCTTTGG + Intergenic
1125994079 15:44139952-44139974 TTCAGATTTGCTGTATCCTTGGG - Intronic
1126269181 15:46792851-46792873 CTCTGATTTGGTGTGTTCTTTGG - Intergenic
1127188076 15:56500823-56500845 CTGTGACTTGGCATCTCCTTTGG - Intergenic
1127668567 15:61172606-61172628 CTCTGAATTGGTCCCTCCTGAGG - Intronic
1127739840 15:61892233-61892255 CTCTGAATAGGCGTTTCCTTTGG - Intronic
1128400492 15:67275043-67275065 CTCTGATTTGGTGTCTCCTTTGG + Intronic
1128502968 15:68241669-68241691 CTCTGATTTGGTGTCTTCTTTGG - Intronic
1133762111 16:8807454-8807476 CTCTCATTTTCTGTCTCCCTAGG + Intronic
1136064173 16:27747656-27747678 CTCAGATTTGGGGGATCCTTTGG - Intronic
1136370088 16:29830805-29830827 CTCTCATTTGGTGTCCTCTTTGG + Intronic
1141069441 16:80939942-80939964 CTCTGCTTTGGGGTCTTATTGGG + Intergenic
1141626089 16:85261862-85261884 CTGTGATTTGGTGCCCGCTTTGG + Intergenic
1141917076 16:87106223-87106245 TTCTTATTTGTTTTCTCCTTAGG + Intronic
1144262672 17:13537933-13537955 CTCAGCTTTGGTGTTTTCTTAGG + Intronic
1144592668 17:16537688-16537710 CTCTCATTTGACCTCTCCTTTGG + Intergenic
1144783972 17:17821766-17821788 CTCTGATCTGGGGTCCTCTTGGG - Intronic
1146726226 17:35158518-35158540 TTGTGAATTGGTGTCTCCCTGGG - Intronic
1146890210 17:36501905-36501927 CTCATCTGTGGTGTCTCCTTTGG - Intronic
1147321500 17:39648909-39648931 CTCTGACTTTCTCTCTCCTTGGG - Intronic
1147665262 17:42143014-42143036 GTCTGATTTGGTCTTTCCTTTGG - Intronic
1148403441 17:47388059-47388081 CTCTGATTTGGTGTCTCCTTTGG + Intronic
1149636271 17:58172460-58172482 CTCTGAGTTGGTGTCTCCTTTGG - Intergenic
1149688200 17:58551018-58551040 CTCTAATTTGGTGTTTCCTGTGG + Intergenic
1149934112 17:60786290-60786312 CCCTGTTTGGGTGTGTCCTTCGG + Intronic
1149949358 17:60968760-60968782 CTCTAATTTGGTGTCTCCTTTGG + Intronic
1150531505 17:65988032-65988054 CTCTGATTTGGTGTCTTTTTTGG - Intronic
1150829121 17:68503059-68503081 CTCTGAGGTGGTGTCTGTTTAGG - Intergenic
1152152077 17:78608030-78608052 CTCTGCTTTAGTTTTTCCTTAGG + Intergenic
1152393162 17:80014973-80014995 ATTTGATTAGGTGTTTCCTTGGG - Intronic
1153474363 18:5481669-5481691 CTCTGATTCAGTGTCTCCTTTGG - Intronic
1153838953 18:8989305-8989327 TTCTGAGTTGGTGTCTCCCAAGG + Intergenic
1153912019 18:9712695-9712717 CTTTGTTTTGTTATCTCCTTGGG + Intronic
1155011919 18:21787347-21787369 CTCTGATTTGATGTCTCTCTTGG + Intronic
1155391474 18:25342045-25342067 CTCTGATTTGCTGTGTGTTTTGG - Intronic
1155978010 18:32152789-32152811 CTCTGATTTAGCATCTTCTTTGG + Intronic
1156050392 18:32925944-32925966 CTTTCATTTGGGGTTTCCTTTGG + Intergenic
1156515762 18:37678858-37678880 CTCTGTTTTGATGTGTCTTTGGG - Intergenic
1157904333 18:51554893-51554915 CACTGATTTGGCATCTCCTTTGG + Intergenic
1159691561 18:71494809-71494831 CTTTGATATGGAGTCTCCCTCGG + Intergenic
1159837212 18:73352736-73352758 CACTAATTTGGTATCTCCTTTGG + Intergenic
1161938219 19:7385365-7385387 CTCTGATTTGGGGTCACCCAAGG + Intronic
1162265749 19:9572532-9572554 CTCTGACTTGGCTTCTCCTTTGG - Intronic
1164518767 19:28960644-28960666 CTCTGCTTAGGTGTCTCACTTGG + Intergenic
1165016613 19:32885782-32885804 CACTGTTTTGGTTTCTTCTTTGG + Intronic
1166256603 19:41610553-41610575 GTCTGATTTCATGTCTCCCTTGG + Intronic
1166974740 19:46599341-46599363 CTCTGATTTGGCATCTCCTTTGG + Intronic
925418677 2:3692735-3692757 CTCTGATTTGGTGTTTCCTCTGG + Intronic
925932450 2:8720126-8720148 CTCTGAATTGGTGAGTTCTTTGG - Intergenic
926600534 2:14839514-14839536 CTCTGATTTGTTATCTCCATTGG - Intergenic
926610845 2:14945055-14945077 CTCTGATTTGGCATCTCCTTTGG - Intergenic
927052022 2:19339225-19339247 CTTTGGCTTGGTGCCTCCTTTGG - Intergenic
927252387 2:21008462-21008484 TTCTAATTTGGACTCTCCTTTGG + Exonic
927523828 2:23719877-23719899 ATTTGCTTTGGTGTCTCATTTGG - Intergenic
928250278 2:29671375-29671397 CATTGATTTGGCATCTCCTTTGG + Intronic
928477198 2:31640717-31640739 CTCTGATTTGGTGTCTCCTTTGG + Intergenic
930358870 2:50353005-50353027 CTCTGATTTGTTATATCATTGGG - Intronic
930943390 2:57041092-57041114 CTCTGATTTGATATCTCCTTTGG + Intergenic
931395064 2:61880517-61880539 TTCTGATTTGTTGTCTACCTTGG + Intronic
931437543 2:62261928-62261950 CTGTGATTTTGTGTTACCTTTGG - Intergenic
931542071 2:63340378-63340400 CCGTGATTTGGCGTCTCCTTTGG + Intronic
932151080 2:69372242-69372264 CTCTTATTTGGTGTCTTCATGGG - Intronic
932799776 2:74730813-74730835 CTCTAATTTGGTGTCTTCTTTGG + Intergenic
932837987 2:75055394-75055416 CTCTGAATTGTCGCCTCCTTTGG + Intronic
932861692 2:75299381-75299403 CTCTGTTTTATTATCTCCTTTGG - Intergenic
932910441 2:75800697-75800719 CTCTGCTCTGCTGGCTCCTTCGG + Intergenic
932931839 2:76050556-76050578 TTCTGATATGGCATCTCCTTTGG + Intergenic
933536064 2:83576123-83576145 CTGTGATTTGGTGGCTGCTGTGG - Intergenic
935090119 2:99887226-99887248 CTCTAATTTGGTCTCTGATTTGG - Intronic
938799303 2:134746023-134746045 CTTTGATTTGGCATCTCTTTTGG - Intergenic
939080413 2:137654325-137654347 CTTTGACTTGGTATCTCCTTTGG + Intronic
939847589 2:147267562-147267584 CTTTGATTTGGTGTCACCTTTGG + Intergenic
940981306 2:160006775-160006797 ATCTAATTTGCTTTCTCCTTAGG - Intronic
940995592 2:160145967-160145989 CCTTGATTTGGTTTCTGCTTTGG + Intronic
941360607 2:164546828-164546850 CTCTGATTTGGTGTCTCCTTTGG - Intronic
941589911 2:167406740-167406762 GTCTGATTTGGTGTCTCCTTTGG - Intergenic
943295732 2:186135784-186135806 CTTTAATTTGCTTTCTCCTTTGG + Intergenic
943548337 2:189309010-189309032 TTCTGATTTGGTGACTCTCTTGG + Intergenic
943659506 2:190543288-190543310 CTCTCATTTGATATCTCTTTTGG + Intergenic
943857663 2:192818751-192818773 CTCTGACTTGGTGTCTTCTCTGG - Intergenic
944519151 2:200545954-200545976 CTCTCATTTGGCGCTTCCTTTGG - Intronic
945676683 2:212863498-212863520 CTCTGCTTTGGCGTCTCCTTTGG + Intergenic
945759218 2:213892075-213892097 TTCTGATTTGGCATCTCCTTTGG - Intronic
946224163 2:218253788-218253810 CTCTCATTTGGTGTTTCTTTGGG + Intronic
946288971 2:218728755-218728777 CTCTGATTTGGTATCTCCTTTGG + Intronic
946550694 2:220798849-220798871 CTCTGATTTAGTGTGGCCTCTGG - Intergenic
948509779 2:238456054-238456076 CTCTGATTTGGCATCTCCTGTGG - Intergenic
948532287 2:238616973-238616995 CTCTGGCTTGGTGTCTTCGTAGG + Intergenic
1169938279 20:10909009-10909031 CTGAGATTTGGAGTCTTCTTGGG - Intergenic
1170863495 20:20130802-20130824 TGCTAATTTGGAGTCTCCTTTGG + Intronic
1170973956 20:21142906-21142928 CTCTGATTTGGTTTCTGCTGAGG + Intronic
1171391387 20:24803658-24803680 CTCTGCTTGGCTGTGTCCTTTGG - Intergenic
1171508348 20:25658199-25658221 CTCTGATTTAGCATCTCCTTTGG + Intergenic
1173482025 20:43409296-43409318 CTCTGATTTGGTATCTCCTTTGG - Intergenic
1173954066 20:47017144-47017166 CTCTGTTCTGGTGCCCCCTTGGG + Intronic
1174338617 20:49882428-49882450 CTCTCCTTTGACGTCTCCTTGGG + Intronic
1175775042 20:61647785-61647807 CTCTGAATGGGTGTTTGCTTAGG + Intronic
1177104845 21:16943058-16943080 TTCTGATTTGGTGTCAACTTTGG + Intergenic
1179771324 21:43619831-43619853 CTCTGATTTGGTGTCTTCTCTGG - Intronic
1180575985 22:16774944-16774966 CTCTGGTTTGGCATCTCCTATGG + Intergenic
1180607978 22:17075575-17075597 CGCTGATTTGCTGTCTCCTTTGG + Intergenic
1180642262 22:17308524-17308546 CTCTTATTAGCTGTGTCCTTGGG + Intergenic
1180872360 22:19153585-19153607 CTCAGTTTTGGTGTCTCCTGTGG - Intergenic
1180918119 22:19503827-19503849 CTCTGATTTGCTGGCCTCTTTGG - Intronic
1181879390 22:25965866-25965888 CTGTGACCTGGCGTCTCCTTGGG + Intronic
1182024480 22:27107230-27107252 TTCTGACTTGTTTTCTCCTTTGG + Intergenic
1183088335 22:35502251-35502273 ATCTCATTTGGTATTTCCTTTGG + Intergenic
1183931956 22:41240490-41240512 GTCTGTTTTGGAGTCTCCTTTGG + Intronic
1184299705 22:43550210-43550232 CTCTGAGCTTGTGTCTCCCTCGG - Intronic
1185244789 22:49767654-49767676 GCCTGACTTGGTGCCTCCTTTGG + Intergenic
949818188 3:8084895-8084917 CTCTAATTTGGTGCCTCCTTTGG + Intergenic
955170797 3:56562977-56562999 CTCTGATTTGTTCTGGCCTTGGG + Intronic
955267829 3:57464270-57464292 CTCTGATTTGGCATCTTCTGTGG - Intronic
955813393 3:62816236-62816258 TTCTGAACTGGTGTCTCTTTAGG + Intronic
956160776 3:66349908-66349930 TTGTGAATTGGTGTCTCATTGGG + Intronic
956362586 3:68464869-68464891 CTCTGATTTCTTCTCTCCTTTGG - Intronic
956471488 3:69571666-69571688 CTCTGCTTTCATGTCTTCTTGGG + Intergenic
957750643 3:84410704-84410726 CTTCAATTTGATGTCTCCTTTGG - Intergenic
960167121 3:114415498-114415520 TTCTGATTTTGTGTCTTGTTTGG + Intronic
960749174 3:120927352-120927374 CTCTAATTTGGTGTCTCCTTTGG + Intronic
962497929 3:135961608-135961630 CTCTGATTTAATGTCTCCTTTGG + Intergenic
962763307 3:138538258-138538280 CTCTGATTTAGCATCTTCTTTGG - Intronic
963404119 3:144840687-144840709 CTCTGATTTGGTGTCTCCTTTGG + Intergenic
963784090 3:149515506-149515528 GTCAGATTTGGTTTCTCCTGAGG - Intergenic
963798669 3:149656837-149656859 CTGTGACTTGGTGCCTTCTTCGG + Intronic
963819269 3:149870024-149870046 CTGTGATTTGGCATCTCCTTTGG + Intronic
963824483 3:149937094-149937116 CTCTGATTTGGCATCTCCTTTGG + Intronic
964537122 3:157735147-157735169 CTCTGATTTGGCATTTCCTTTGG - Intergenic
964710420 3:159665907-159665929 CTCAGGTTAGGCGTCTCCTTGGG + Intronic
965094675 3:164209708-164209730 CTCAGATTTGGCATCTTCTTTGG - Intergenic
965495323 3:169390766-169390788 CTGAGTTTTGGTCTCTCCTTTGG - Intronic
965509561 3:169553696-169553718 CGCAGGTTTGGTGTCTCCTGCGG + Intronic
966020331 3:175202166-175202188 CTCTGCTTTGATGCCTCCTTGGG + Intronic
966127781 3:176600061-176600083 CTCTGATTTGGCATCTCCTTTGG - Intergenic
967523983 3:190470966-190470988 TTCTGATTTGATATCTCCTTTGG - Intergenic
968966207 4:3770188-3770210 CTCTGAGGTGGGGTCTCCTGTGG - Intergenic
969473825 4:7409427-7409449 CTCTGATTTGGAGTCCCCTTTGG + Intronic
969629131 4:8325296-8325318 CTCTGAGTCCGTGTCTCCTCTGG - Intergenic
969735788 4:8989237-8989259 CTCCGAATTGATGACTCCTTTGG - Intergenic
970547934 4:17148670-17148692 CTCTGATCTGGTCTCAACTTGGG - Intergenic
971214422 4:24650248-24650270 CTCTGTTTTGGTCCCTCCTGAGG - Intergenic
972042385 4:34619615-34619637 TTCTGGATTGCTGTCTCCTTGGG - Intergenic
972475513 4:39446177-39446199 CTCTGTTTTCTGGTCTCCTTGGG + Intronic
972767803 4:42167831-42167853 CTCTGTTTTGTTGTCCCCTGAGG + Intergenic
973801475 4:54482890-54482912 CTCTGATTTGCAGCCTCATTTGG - Intergenic
975345377 4:73287099-73287121 CTTTGATTTGGCGTCTCCTTTGG - Intergenic
975418466 4:74134261-74134283 TACTGATTTGGCATCTCCTTTGG - Intronic
975418913 4:74139342-74139364 CTCTGATTTGGCATCTCCTTTGG + Intronic
975419605 4:74147455-74147477 CTCTAATTTGGCATCTCCTTTGG + Intronic
976135446 4:81931189-81931211 CTCTGATGTGATGTGTCATTTGG - Intronic
977872230 4:102105826-102105848 CTCTGATTTGGTGTCTCCTTTGG - Intergenic
978333532 4:107641714-107641736 CCCTGATTTGGGATATCCTTTGG - Intronic
978379378 4:108111093-108111115 CTTTCATTTGGTGTATCCTATGG - Intronic
979380794 4:120004161-120004183 CTCTGATTTAACGTCTGCTTTGG - Intergenic
980066213 4:128191656-128191678 CTCTGATATGGCATCTCTTTTGG + Intronic
980186095 4:129462984-129463006 CTCTCATTTGGTCTCTCATAGGG - Intergenic
980247887 4:130271059-130271081 CTCTGATTTTGTGTCTCCTTTGG + Intergenic
980806399 4:137820227-137820249 CTCTGATTTTGTGTTTCCTCTGG + Intergenic
981459063 4:144990976-144990998 CTCTGATGTGGCATCTCCTTTGG - Intronic
981900689 4:149858350-149858372 CTTTAATTTGGTGTTTCCTTTGG - Intergenic
982280183 4:153676347-153676369 CTCTGATTTGGCATCTCCTTTGG + Intergenic
982910638 4:161137600-161137622 CTCTGATTTGGCATCTCCTTTGG - Intergenic
983455560 4:167958723-167958745 CTCTGATTGGCTGTCTCCTTTGG - Intergenic
983860976 4:172706837-172706859 CTCTAACTTGCTGTCTCCTTTGG + Intronic
984351603 4:178601329-178601351 CTCTGATTTGATGTCTCCTTTGG + Intergenic
985562327 5:594820-594842 CTCTGGCTTGGTGCTTCCTTTGG - Intergenic
986241331 5:5962195-5962217 CTCTGATTCGGGTTCTCCTGAGG + Intergenic
987189699 5:15463518-15463540 CTCTGATTTGGCATTGCCTTTGG + Intergenic
987611066 5:20203343-20203365 CCATGATTTGTTGTCTCCTTTGG - Intronic
988145085 5:27294829-27294851 AACTGGTTTGGTGTCTTCTTAGG - Intergenic
989129492 5:38092600-38092622 CTCTGGTTTGGTGGCTGCTGTGG + Intergenic
989354643 5:40529763-40529785 CTCTGACTTTGAGTCTCTTTTGG - Intergenic
989390343 5:40894094-40894116 CTCTAATTTGGCATTTCCTTTGG + Intergenic
989663139 5:43821426-43821448 CTCTGATTTGGAATCTCCTTTGG - Intergenic
989806557 5:45614470-45614492 CTTTCTTTTTGTGTCTCCTTTGG - Intronic
990469599 5:56102542-56102564 CCCTGATTTTGTGTCTGTTTGGG + Exonic
991011594 5:61888381-61888403 CTTTGCTTTGCTGTTTCCTTTGG - Intergenic
992654979 5:78900230-78900252 CTCTGATTTGGTGTCTCATTTGG + Intronic
992744291 5:79804104-79804126 CCCTGATTTGGTGACTTCTAGGG + Intergenic
993034718 5:82744457-82744479 ATGTAATTTGGTGTTTCCTTTGG - Intergenic
993054612 5:82967997-82968019 CTCCCATTTGGTGTCTCCTTTGG - Intergenic
993241023 5:85385491-85385513 CTCTGATTTGCTGACACTTTTGG + Intergenic
993600377 5:89915791-89915813 TTCTCATTTGGTGTCTTCTTTGG - Intergenic
994134250 5:96266482-96266504 CTCTGATTTGGTGTCTCCTTTGG - Intergenic
995538707 5:113163349-113163371 CTCTGTTTTGGTGACAACTTAGG - Intronic
995549801 5:113269449-113269471 ATTTGTTTTGGTGTCACCTTGGG - Intronic
995606377 5:113860108-113860130 CTTTGATTTGGCAACTCCTTTGG + Intergenic
996067160 5:119091833-119091855 CTCTCATGTGGCATCTCCTTTGG + Intronic
996113452 5:119592312-119592334 CTCTGATTGGAAATCTCCTTTGG - Intronic
996985189 5:129553610-129553632 CTCTGTTTTGCTGATTCCTTAGG + Intronic
997096000 5:130912093-130912115 TTCTGATTTGGCATCTCCTTAGG - Intergenic
997111946 5:131085082-131085104 CTCTGATTTGTCATCTCCTTTGG + Intergenic
999561105 5:152803901-152803923 CTCTGCTTCTGTGTCTCCTCTGG + Intergenic
999800395 5:155028034-155028056 CTGTGATTTGGCATCTCCTTTGG - Intergenic
999969762 5:156847584-156847606 CCCTGATTTGGCATCTCTTTTGG - Intergenic
1000254593 5:159525710-159525732 ATCTGATTTGGAGTTTACTTAGG + Intergenic
1000806115 5:165794852-165794874 CTAAGATTTGGCATCTCCTTTGG + Intergenic
1003079619 6:3010716-3010738 CTCTGGTTTGGCATCTCCTTTGG - Intronic
1003105505 6:3211943-3211965 CTCTAATCTGGTGTCTCCTGTGG + Intergenic
1003590865 6:7435553-7435575 CTCTGACTTGGTGCCTCCTTTGG - Intergenic
1003634113 6:7816022-7816044 GTCTGACTTGGTGACTCTTTAGG + Intronic
1003657760 6:8029602-8029624 CTTTGATTTGGTGTCTCCTTTGG - Intronic
1003775337 6:9354370-9354392 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1003819276 6:9877859-9877881 CTCTGGTGTGGTGCCTCCATTGG - Intronic
1003908913 6:10726013-10726035 GTCTGCTTTGGCGTCTCCTTAGG + Intronic
1004645268 6:17554377-17554399 CTCTGATTTGGTATCTCTTTTGG - Intronic
1005767055 6:29022272-29022294 CGCTGATTTGGCGTCTCCTTTGG + Intergenic
1006661267 6:35647516-35647538 CTCTTCTTTGCTCTCTCCTTCGG - Intronic
1007040801 6:38720329-38720351 CTCTGATTTGGTGTCTTCTTTGG - Intronic
1008138842 6:47808463-47808485 CTCAGATGTGCTGTCTTCTTAGG + Intronic
1010353121 6:74899711-74899733 CTCTGATTTGGCATCTCCCTTGG + Intergenic
1011615489 6:89194166-89194188 CTCTGATTTGGCATCTCCTTTGG - Intronic
1011756873 6:90508970-90508992 CTCTGATTTGGTGTTTCTTTTGG + Intergenic
1012505409 6:99940929-99940951 CTCTGATTTAGTGTCTCCTTTGG + Intronic
1012744520 6:103067989-103068011 CTCTGATTTGGTATCTTTTTTGG + Intergenic
1013799904 6:113931012-113931034 CCCTGATTTAGCATCTCCTTCGG + Intergenic
1014897436 6:126920094-126920116 CTATGCTTTGCTGTCTCCTAAGG - Intergenic
1014957750 6:127641998-127642020 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1015052634 6:128861163-128861185 CTTTCATTTTGTGTGTCCTTTGG + Intergenic
1015216853 6:130760048-130760070 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1016155380 6:140800356-140800378 CTCTGATTTGGCATCTCCTTTGG + Intergenic
1016263768 6:142207417-142207439 TTCTGATTTGGTGTCTCCTTTGG - Intronic
1017934135 6:158989562-158989584 CTCTGATTTGGTGTTTCCTTTGG + Intronic
1019131342 6:169879145-169879167 CTCTCGTTTGGCGTCTCCTGTGG + Intergenic
1021771833 7:24010839-24010861 CTTTGATTTGGCATCTCCTTTGG + Intergenic
1022068520 7:26886542-26886564 CTCTGATTTGATGTCTCTTTTGG + Intronic
1022905843 7:34855520-34855542 TTCTGATTTTGTTTCTTCTTGGG - Intronic
1022966421 7:35477656-35477678 CTCTGTTTTGGCATCTCCTTTGG - Intergenic
1023749195 7:43353889-43353911 CTCTGATTTAGTGTCTCCTTTGG - Intronic
1024412433 7:49060595-49060617 CTCCGATTTGGCATCTCCTTTGG + Intergenic
1025040640 7:55641553-55641575 CTGTGATTTGGCATCTCCTTTGG + Intergenic
1026082946 7:67238473-67238495 CTCTGATGTCTTGTGTCCTTGGG - Exonic
1026694113 7:72575532-72575554 CTCTGATGTCTTGTGTCCTTGGG + Exonic
1027556044 7:79665913-79665935 CTCTGTTTTGGCTTTTCCTTTGG + Intergenic
1028152160 7:87386764-87386786 CTTTGATTTGGTGTCTTTTTTGG + Intronic
1028192340 7:87867983-87868005 CTATGATTTGGCATCTCCTTTGG + Intronic
1028543519 7:91972207-91972229 GTCTGATTTGGCGTCTCCTTTGG + Intronic
1028560359 7:92168432-92168454 CTCTGATGTGGTGTCTCCTTTGG - Intronic
1028747443 7:94343630-94343652 CTCAGACTTGGTGTCACTTTGGG - Intergenic
1029806647 7:103004457-103004479 CTCTGATTTAGTGTCTCCTTTGG + Intronic
1030212961 7:107014737-107014759 CTCTGATTTGTTGTTGCATTTGG - Intergenic
1030533707 7:110740361-110740383 CTCTGATTTTGTTTCTAATTGGG - Intronic
1031569430 7:123340937-123340959 CTCTGATTTGGTGTCTACTTTGG + Intergenic
1034569769 7:151945926-151945948 CTCTGGTCTTGTGTCTCCTGAGG - Intergenic
1035366839 7:158353977-158353999 CTCTGATTGAGTGCCTCCTTTGG - Intronic
1035445223 7:158936670-158936692 CTCTGATTGAGTGCCTCCTTTGG - Intronic
1036643185 8:10596718-10596740 CTCTGATTTGCAGGCTCCATGGG - Intergenic
1036727655 8:11233781-11233803 CTCTGATGAGCTGTGTCCTTGGG + Intergenic
1037149089 8:15613883-15613905 CTCTGTTTGGGTGTCCCTTTTGG - Intronic
1037282775 8:17261842-17261864 CTCTGATTTGGTGTTTTCTTTGG + Intronic
1037311360 8:17560102-17560124 CTCTGATTTGGTGACTACTGGGG + Intronic
1037595105 8:20348353-20348375 CTTTGGTTTGGGATCTCCTTGGG - Intergenic
1038691296 8:29765758-29765780 CTGTGATTTGGTTTCTGCTTTGG - Intergenic
1040062392 8:43115067-43115089 CTCTCATTTTGTGTAACCTTTGG + Intronic
1040338134 8:46426575-46426597 GCCTGCTTTGGTGTCTCCCTCGG - Intergenic
1041322121 8:56624133-56624155 CCCTGATGAGGTGTCTCCTTGGG + Intergenic
1042861464 8:73318306-73318328 CTCTGATTTTGTGCCACCTCTGG + Intronic
1043256108 8:78138641-78138663 CTCTGAGTAGGTGTGGCCTTGGG - Intergenic
1043614924 8:82113888-82113910 AGCTGATTTGGTGTCTACTGAGG + Intergenic
1044003851 8:86917677-86917699 CTCTGGATTGGTATCTACTTAGG - Intronic
1044744353 8:95357727-95357749 CTCATGTTTTGTGTCTCCTTCGG + Intergenic
1046415974 8:113914580-113914602 CTCTGATTTGGCATCGCCTTTGG - Intergenic
1047410250 8:124618630-124618652 CTCATACTTGGTGTCTCCTTTGG - Intronic
1048080118 8:131117792-131117814 CTCTGATTTGGGACCTCTTTTGG + Intergenic
1049484646 8:142848745-142848767 CCCTGATTTACTGTCTCCTTTGG + Intronic
1049537069 8:143187397-143187419 CTCAGATTTGGGGTCGCCTATGG - Intergenic
1049953595 9:670625-670647 CTCTGATTTGGCGTCTCCTTTGG + Intronic
1050449449 9:5764639-5764661 CTCTGCTTGAGTGTCTCCTCTGG - Intronic
1050564338 9:6866494-6866516 CTCTGATTTGGCATCTCCGTTGG + Intronic
1050807418 9:9698539-9698561 CTCTAATTTGGCATCTCCTTTGG + Intronic
1052689541 9:31800009-31800031 CTCTGATTTGGTGGTTTCTTTGG - Intergenic
1052734668 9:32328784-32328806 GTCTGATTTGGCATCTTCTTTGG - Intergenic
1052763027 9:32611897-32611919 CCCTGATTTGGTTTCTCTTGGGG + Intergenic
1053101507 9:35375615-35375637 CCTTGATTTCGTGTCTCCTCTGG - Intronic
1053127240 9:35592196-35592218 CTTTAATTTGGCATCTCCTTTGG - Intergenic
1053186850 9:36023475-36023497 CTTTGATTAGGGGTCTCCTCTGG + Intergenic
1053460295 9:38263574-38263596 CTCTGATTTAATGTCTCCTTTGG - Intergenic
1058096105 9:100862191-100862213 CTCTGATTTTCTGTGTGCTTGGG + Intergenic
1058316489 9:103573598-103573620 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1060149605 9:121279849-121279871 CTCTGCTTTGGTCTGTCCCTTGG + Intronic
1060166952 9:121425287-121425309 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1060563562 9:124568686-124568708 CACTGATTTGCTGTGTCCTTGGG - Intronic
1062451411 9:136617263-136617285 CTCTGATCTGTTGCCTCTTTGGG + Intergenic
1186230628 X:7449890-7449912 CTATGTTTTTGTGTCTCATTTGG - Intergenic
1186876502 X:13823421-13823443 CACTGTTTTGGTGGCTCCTGAGG - Intronic
1186940336 X:14500169-14500191 CTCAGATTTGATGTCTCCTTTGG - Intergenic
1186963659 X:14764137-14764159 CTCTGTTTTGGGGTCTCCCAAGG + Intergenic
1186994722 X:15107720-15107742 CTCTGATTTGATATCTCCTTTGG + Intergenic
1187714229 X:22086240-22086262 CTCTGATTTGGTGTCTCCTTTGG + Intronic
1187941409 X:24386359-24386381 CTCTGATTTGGCATCTCCTTTGG + Intergenic
1188882516 X:35506632-35506654 CACTGATTTGGTTTCACCCTAGG - Intergenic
1188903137 X:35759767-35759789 CTCTGATTTGGCATCTCCTACGG + Intergenic
1189127044 X:38459773-38459795 CTCTCATTGGATGTCTCCTTAGG + Intronic
1190501597 X:51084363-51084385 CTTAGATTTGGTGGCTTCTTAGG + Intergenic
1190508153 X:51149186-51149208 CTCTGATTTGATGTCTCTTTTGG + Intergenic
1190976956 X:55414647-55414669 CTGTAATTTGGGGTCTCCATTGG + Intergenic
1191800708 X:65076035-65076057 TGTTGACTTGGTGTCTCCTTTGG + Intergenic
1192504605 X:71673553-71673575 CTCTGATTTGGCATCTCCTTTGG - Intergenic
1192521934 X:71809851-71809873 CTCTGATTTGGCATCTCCTTTGG + Intergenic
1193178245 X:78420840-78420862 CTCTAATTTAGCATCTCCTTTGG - Intergenic
1193598697 X:83481282-83481304 CTCTAATTTGATGTATCCTTTGG - Intergenic
1194015418 X:88613348-88613370 CTCTGAATTGATGTCTCCTTTGG - Intergenic
1194849624 X:98855249-98855271 CTCTAATTTGGTGTTTCCTTTGG + Intergenic
1195073571 X:101304664-101304686 CTCTGATTTGGCATCTCCTTTGG + Intergenic
1195491990 X:105481243-105481265 GTCTTATTTGGTGTCCCCTTGGG - Intronic
1197260610 X:124313181-124313203 CTCTGATTTGGTATCTCCTTTGG - Intronic
1197551106 X:127893843-127893865 CTCTGATTTTGCGTCTTCTTTGG + Intergenic
1197623605 X:128779535-128779557 ATCTTGGTTGGTGTCTCCTTAGG + Intergenic
1197660170 X:129162175-129162197 CTAAAGTTTGGTGTCTCCTTTGG + Intergenic
1199133286 X:144220080-144220102 CTCTGATTTGGTGTGTCCTTTGG + Intergenic
1199194819 X:145015982-145016004 GTTTGATTTGGTATCTCCTATGG - Intergenic
1199326830 X:146508999-146509021 ATCTGACTTGGTGTCCCCTCTGG + Intergenic
1199459561 X:148069593-148069615 CTTTGGTTTAGTGTCGCCTTTGG + Intergenic
1199602537 X:149550655-149550677 CTGTGCTTTGGAGTCTCCTGTGG + Intergenic
1199647851 X:149928820-149928842 CTGTGCTTTGGAGTCTCCTGTGG - Intergenic
1200295748 X:154918291-154918313 CTCTCATTTGGTGTCTTCTTTGG + Intronic
1201348696 Y:13014859-13014881 CTCAGATTTTCTGTTTCCTTAGG + Intergenic