ID: 941360609

View in Genome Browser
Species Human (GRCh38)
Location 2:164546840-164546862
Sequence GCTGAACAGCCACTCTGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 21, 1: 71, 2: 56, 3: 63, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941360609_941360613 9 Left 941360609 2:164546840-164546862 CCAAATCAGAGTGGCTGTTCAGC 0: 21
1: 71
2: 56
3: 63
4: 141
Right 941360613 2:164546872-164546894 CGATAGGAGGTTCATCCCACAGG No data
941360609_941360614 17 Left 941360609 2:164546840-164546862 CCAAATCAGAGTGGCTGTTCAGC 0: 21
1: 71
2: 56
3: 63
4: 141
Right 941360614 2:164546880-164546902 GGTTCATCCCACAGGTCCCCTGG No data
941360609_941360611 -4 Left 941360609 2:164546840-164546862 CCAAATCAGAGTGGCTGTTCAGC 0: 21
1: 71
2: 56
3: 63
4: 141
Right 941360611 2:164546859-164546881 CAGCAGCACCACACGATAGGAGG No data
941360609_941360615 23 Left 941360609 2:164546840-164546862 CCAAATCAGAGTGGCTGTTCAGC 0: 21
1: 71
2: 56
3: 63
4: 141
Right 941360615 2:164546886-164546908 TCCCACAGGTCCCCTGGCCATGG No data
941360609_941360610 -7 Left 941360609 2:164546840-164546862 CCAAATCAGAGTGGCTGTTCAGC 0: 21
1: 71
2: 56
3: 63
4: 141
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data
941360609_941360617 24 Left 941360609 2:164546840-164546862 CCAAATCAGAGTGGCTGTTCAGC 0: 21
1: 71
2: 56
3: 63
4: 141
Right 941360617 2:164546887-164546909 CCCACAGGTCCCCTGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941360609 Original CRISPR GCTGAACAGCCACTCTGATT TGG (reversed) Intronic
904275291 1:29379836-29379858 GCTTAATGGCCACTCTGATTTGG + Intergenic
907264027 1:53244447-53244469 GCTGAAAAGCCTCTATGAATGGG + Intergenic
908429406 1:64041332-64041354 GGAGACCAGCCACTCTAATTTGG + Intronic
909460609 1:75908971-75908993 GCTGTACATCCACACTGATTTGG + Intronic
909470990 1:76027887-76027909 GCTGAACAGCCACTCTGATTTGG - Intergenic
911314120 1:96335097-96335119 GCTGATCCTCCAATCTGATTGGG - Intergenic
911485975 1:98505475-98505497 GTTGAACAGCTACTCTGATGTGG - Intergenic
912016286 1:105040663-105040685 GCCGAATAGCCATTCTGGTTTGG - Intergenic
912160387 1:106975999-106976021 GCTGAACAGCCACTCTTTTTTGG - Intergenic
912640666 1:111342553-111342575 GCTGAACAGCCACTCTGATTTGG + Intergenic
912731345 1:112109069-112109091 GCTCAACAGCAACTCTTATTTGG + Intergenic
913712468 1:121499395-121499417 GCTGAATAGCCAATCTGATTTGG - Intergenic
913764667 1:122175541-122175563 GTTGAACATCCACTTTGATGGGG + Intergenic
915035099 1:152915615-152915637 GCCGAACAGCCAGTCTGATTTGG - Intergenic
915880372 1:159664812-159664834 GCTGAACAGCCACTCTGATTTGG + Intergenic
915966734 1:160315401-160315423 GCTGAGCAGCCACTCTGATTTGG - Intronic
916882797 1:169036451-169036473 GCTGAACAGTCACTCTGATTTGG - Intergenic
917425051 1:174904583-174904605 ACTGAACAGCCACTTTTATGTGG - Intronic
917787447 1:178473834-178473856 GTTGGACAGCTAATCTGATTTGG + Intronic
919736159 1:200952510-200952532 GCTCATCTGCCACTCTGATTGGG + Intergenic
920838008 1:209529814-209529836 GCTGAGCAGCCTCTCTGGCTGGG - Intergenic
921241433 1:213188056-213188078 GCTGAGCAGCCTCTCAGATTGGG + Intronic
921494655 1:215824570-215824592 GCTGAACAGCCACTCTGATTTGG + Intronic
922431561 1:225560045-225560067 GCTGAACAGCCACTTTGACTCGG - Intronic
923937657 1:238781397-238781419 GCTGAACAGACATTCTGATTTGG + Intergenic
924647156 1:245888767-245888789 GCTGAAATGACACTCAGATTGGG - Intronic
1063385623 10:5614543-5614565 GATTAACAGACACTCTAATTAGG + Intergenic
1063880503 10:10526854-10526876 GCTGAACAACCACTCAGAGCTGG + Intergenic
1064697651 10:17984044-17984066 TCTGAGCAGCTACTCTGAATAGG - Intronic
1065496571 10:26335426-26335448 GCCAAACTGCCTCTCTGATTTGG + Intergenic
1067520298 10:46995556-46995578 ACTAAACAACCACTCTGGTTTGG + Intronic
1068999153 10:63244170-63244192 GCTGAACTGCCACTCTGATATGG - Intronic
1069128318 10:64666531-64666553 GCTGAACGGCCACTCTAATTTGG + Intergenic
1069804694 10:71112996-71113018 GCTGAACAGCCACTCTGACTTGG + Intergenic
1070040356 10:72772188-72772210 GCTGAACAGCCACTATGATTTGG - Intronic
1070169222 10:73920159-73920181 ACTGAACAGCCACTCGGCTTGGG - Intronic
1070504883 10:77104379-77104401 GCTGAGCCGCCATTCTGGTTTGG - Intronic
1070765005 10:79051331-79051353 GCTGAGCAGCCACTGTGACAGGG - Intergenic
1071947236 10:90658962-90658984 CCTGAGCAGCCACTGTGATATGG - Intergenic
1072054884 10:91745208-91745230 GTTGAATGGCCACTCTAATTTGG - Intergenic
1072485207 10:95848125-95848147 ATAGAACAGCCACTCTGATTTGG + Intronic
1072772097 10:98150729-98150751 GCTGAACAGCTGTTTTGATTTGG + Intronic
1075950112 10:126469833-126469855 GTTGAACACCCACTCTGCATGGG + Intronic
1077930296 11:6724258-6724280 GCTAAACAGCCACTCTGATTTGG - Intergenic
1080093933 11:28382236-28382258 ACTGAACAGCCACTCTGATGTGG + Intergenic
1080353879 11:31418768-31418790 GCTAATCAGCTACTCTGCTTAGG + Intronic
1080716994 11:34812489-34812511 GCTGAACAACCATTCTGATTTGG - Intergenic
1080789371 11:35508008-35508030 ACTGAATCACCACTCTGATTTGG + Intronic
1081001607 11:37680233-37680255 GCTGAACCATCTCTCTGATTTGG - Intergenic
1081776385 11:45678539-45678561 GCTGAGCAGCTACTCAGCTTTGG + Intergenic
1082935429 11:58652110-58652132 GCTGAGCAGCCACTCTGATTTGG + Intronic
1086035959 11:82414686-82414708 GCTAAAAAGCAAGTCTGATTTGG - Intergenic
1086113347 11:83221774-83221796 GCTGAACAGCCACTCTGATTTGG + Intronic
1086851163 11:91810857-91810879 GCCGAAGAGCCACTCTGATTTGG + Intergenic
1087676341 11:101166335-101166357 ACTGAACAGTCACTCTGATTTGG + Intergenic
1088592798 11:111417740-111417762 AGAGAACAGCCACTCTGCTTCGG + Intronic
1089192681 11:116665052-116665074 GTTAAACAGCTACTCTGATTTGG - Intergenic
1091865957 12:3837112-3837134 GCTGAATAGCCACTCTGATTTGG - Intronic
1092037601 12:5351262-5351284 GCTAAACAGCAAGTTTGATTTGG + Intergenic
1092756952 12:11772677-11772699 GGTGAACAGACGCTCTGACTTGG - Intronic
1092941390 12:13410449-13410471 GCTAAACAGCCACTCTGATTTGG - Intergenic
1093142662 12:15527533-15527555 GCTGAACAGCCACTCTGATTTGG - Intronic
1093166086 12:15805492-15805514 GCTGATTGGACACTCTGATTTGG - Intronic
1093535737 12:20220358-20220380 GCCAAACAGCCACTATGATTTGG - Intergenic
1093751933 12:22809172-22809194 GCAGAACAGCCACTTTTATCCGG - Intergenic
1095898987 12:47307794-47307816 GCTGAACAGTCACTCTGATTTGG - Intergenic
1096889982 12:54760098-54760120 GCTGAACAGACACTCTGATTTGG + Intergenic
1097486992 12:60215342-60215364 GATGAGCAGCAAATCTGATTTGG + Intergenic
1099093607 12:78343557-78343579 GCTGAACCAACACTCTGATCTGG - Intergenic
1099434550 12:82627881-82627903 GCTGAACAGCCACTCTGATTTGG - Intergenic
1099800844 12:87454590-87454612 GTTGAACAGTCACTCTGATATGG - Intergenic
1100804461 12:98266784-98266806 CCTGAACAGCCACTCTGCTCTGG - Intergenic
1101364360 12:104058016-104058038 GCTGAACAGCCACTATGATTTGG + Intronic
1105731718 13:23224267-23224289 GTTGAAGAGCCACTCTAATAAGG + Intronic
1106196207 13:27496289-27496311 GCTGAGCACCCACTCTGAGCAGG - Intergenic
1106576728 13:30981635-30981657 GATGTACAGCCACTATGATTAGG + Intergenic
1106859769 13:33893146-33893168 GCTGAACAACCACTCTGATTTGG - Intronic
1107090981 13:36479124-36479146 ACTGAACAGCCACTCTGATTTGG - Intergenic
1107195118 13:37642407-37642429 ACTGAGAAGCCACTCTGATTTGG + Intronic
1108157843 13:47604635-47604657 GCAAATCAGCCACTCTGACTTGG - Intergenic
1108769414 13:53680282-53680304 GCTGAACAGTGATTCTGACTTGG + Intergenic
1108891798 13:55270561-55270583 GATGAATAGCCACCCTGAATAGG - Intergenic
1109214494 13:59572503-59572525 GCTGAACAGCAACTTTGATTTGG - Intergenic
1109362714 13:61316861-61316883 GCTGAACAGCCACTTTGGTTTGG + Intergenic
1111671746 13:91340013-91340035 GCTGAACAGCCATTCTAATTTGG + Intergenic
1112480038 13:99766885-99766907 GCTAAACAGCCACTCTGATTTGG + Intronic
1113541175 13:111111207-111111229 GGTGAAGACCCACTCTGATCTGG - Intergenic
1113912040 13:113846964-113846986 ACTGGAAAGCCACTCTGCTTTGG + Intronic
1114325912 14:21588426-21588448 GTTGAACAGCCACTCTGATTTGG - Intergenic
1115279676 14:31647591-31647613 GCTGAACAGTCAGTCTGATTTGG + Intronic
1115955890 14:38778549-38778571 GCCATACAGCCACTCTGATTTGG - Intergenic
1116031342 14:39576607-39576629 GCTGAACAGCCACTCTGATTTGG + Intergenic
1116514008 14:45784450-45784472 GCTAAACAGCCACTCTGATATGG + Intergenic
1116745596 14:48814575-48814597 GCTGAACAGCCACTCTTATTTGG - Intergenic
1121752828 14:96372393-96372415 CCTGAACAGCATCTCTGCTTTGG - Intronic
1122852922 14:104546579-104546601 CCTGAACTCCCTCTCTGATTTGG - Intronic
1124078766 15:26471500-26471522 CCTGAATATCCACTCTGATTAGG + Intergenic
1124078913 15:26473093-26473115 CCTGAATCTCCACTCTGATTAGG + Intergenic
1125365539 15:38911495-38911517 GCTGAACAGCCACTGTGATTTGG + Intergenic
1126269183 15:46792863-46792885 ACTGAACAGCCACTCTGATTTGG - Intergenic
1126379571 15:48032059-48032081 GCTGATCAGCTTCTCTGATCGGG + Intergenic
1126898306 15:53284072-53284094 TCTAAACAGCCACACTGATTAGG - Intergenic
1127188078 15:56500835-56500857 GCTGAACAACCTCTGTGACTTGG - Intergenic
1127719916 15:61689253-61689275 GCTAAGCAGCCACTCTGATGAGG + Intergenic
1127739842 15:61892245-61892267 GCTGAACAGCCACTCTGAATAGG - Intronic
1128502970 15:68241681-68241703 TGCTAACAGCCACTCTGATTTGG - Intronic
1132512023 16:347875-347897 TCTGAAAAGCCTCTCTGATGAGG + Intronic
1133082969 16:3338165-3338187 GCTAAGCAATCACTCTGATTTGG + Intergenic
1133570653 16:7036855-7036877 GCTCATCATCCACTCTGATGAGG - Intronic
1134264343 16:12680607-12680629 TCTGCACAGCCCCTCTGATCTGG + Intronic
1134346479 16:13396595-13396617 ACTGAACAACCACTCTATTTAGG - Intergenic
1138974230 16:62184349-62184371 GCTGAATGTCCATTCTGATTTGG + Intergenic
1139529655 16:67536930-67536952 GCTCAACAGCCACTCTTTTTTGG + Intronic
1142271125 16:89089804-89089826 GCTGCAGAGCCGCTCTTATTTGG + Intronic
1143324732 17:6091430-6091452 GCTGCATGGCCACTCTGTTTGGG + Intronic
1148111181 17:45145284-45145306 GCTGAATAGCCCCTGTGATAAGG + Intergenic
1148403439 17:47388047-47388069 GCTGAACAGCCACTCTGATTTGG + Intronic
1149636272 17:58172472-58172494 GCTGGACAGCAACTCTGAGTTGG - Intergenic
1149949356 17:60968748-60968770 GCTGAACAGCCACTCTAATTTGG + Intronic
1150531506 17:65988044-65988066 GTTGAACAGTCACTCTGATTTGG - Intronic
1153476480 18:5504238-5504260 GCTGAACACTCACCCTGAGTTGG + Intronic
1153722607 18:7922264-7922286 GCTTAACAGCCACTCTGATTTGG + Intronic
1154296719 18:13157751-13157773 GCTGAACAGCCTCTCTGATTTGG + Intergenic
1156758556 18:40558552-40558574 GCTGAACACTCACTCTCAGTGGG + Intergenic
1157808680 18:50677874-50677896 GCAGAGCAGCCACTCTGGGTGGG - Intronic
1157904332 18:51554881-51554903 GCTGAAAAGCTGCACTGATTTGG + Intergenic
1157917470 18:51680303-51680325 GCTGAACAGCCACTCTGATTTGG - Intergenic
1159837210 18:73352724-73352746 GCTGAACAACCACACTAATTTGG + Intergenic
1159906353 18:74096277-74096299 ACTGAACAGCCACAGTGATTTGG - Intronic
1160683907 19:424745-424767 GCTGAACCCCCAGTCTGGTTGGG - Intronic
1162265751 19:9572544-9572566 CCTGAACAGCCACTCTGACTTGG - Intronic
1165037511 19:33044535-33044557 GCAAAACAGCCACTGTGAATTGG + Intronic
1166285866 19:41827892-41827914 GCTGAAAAGCCACTCATATTTGG + Intergenic
1166974738 19:46599329-46599351 AACGAACAGCCACTCTGATTTGG + Intronic
925418676 2:3692723-3692745 GCTGAACAGCAACTCTGATTTGG + Intronic
926147887 2:10407785-10407807 GCTGAGCAGCTTCTCTGACTGGG + Intronic
926610847 2:14945067-14945089 GCTGAACAGCCACTCTGATTTGG - Intergenic
926875398 2:17471155-17471177 GCTGAACAGCCACTTTAATTTGG + Intergenic
927887173 2:26725662-26725684 GCTGTAGAGCCACTGTGCTTAGG - Intronic
927890156 2:26743128-26743150 GCCAAAAAGCCACTCTGATTTGG + Intergenic
928250276 2:29671363-29671385 GCTGAACAGCCACATTGATTTGG + Intronic
928477196 2:31640705-31640727 ACTGAACAGCCACTCTGATTTGG + Intergenic
931542068 2:63340366-63340388 GCTGAATAACCACCGTGATTTGG + Intronic
933361045 2:81284989-81285011 GCTGAGCTTACACTCTGATTTGG + Intergenic
933566425 2:83955879-83955901 CCTGTATATCCACTCTGATTTGG - Intergenic
936803558 2:116296597-116296619 GCTGAAAAGCCTATCTGATTTGG - Intergenic
938799305 2:134746035-134746057 GTTGAAAAGCCACTTTGATTTGG - Intergenic
938962406 2:136355178-136355200 GCTGGACAGCCTCTTTGAATAGG + Intergenic
939080411 2:137654313-137654335 GCTGAACAGCCACTTTGACTTGG + Intronic
939217608 2:139259960-139259982 ACTGACCAGCCACTCTGAACTGG + Intergenic
939847587 2:147267550-147267572 GCTGAATAGCCACTTTGATTTGG + Intergenic
940120595 2:150260327-150260349 GCTGAACAGCCAGTCCCATTAGG - Intergenic
941360609 2:164546840-164546862 GCTGAACAGCCACTCTGATTTGG - Intronic
941862031 2:170292778-170292800 GCTGAACAGCCACTCTGATTTGG + Intronic
942675874 2:178426553-178426575 GCTGAGTAACCACTCTGATCTGG + Intergenic
942976310 2:182022507-182022529 AGTAAACAGCCACTCTGAGTTGG - Intronic
943102480 2:183505188-183505210 GCTGAACAACTGCTCTGATTTGG + Intergenic
943949999 2:194121320-194121342 GCGGAACAGCCACTCTGATTTGG - Intergenic
944020290 2:195094676-195094698 TCTGAACAGCCACTCTGATTTGG - Intergenic
945676681 2:212863486-212863508 GCTGAACAACCACTCTGCTTTGG + Intergenic
945759219 2:213892087-213892109 GCTATACAGTCATTCTGATTTGG - Intronic
946288969 2:218728743-218728765 GCTGAACAGCCACTCTGATTTGG + Intronic
948509781 2:238456066-238456088 GCTGAACAGCCACTCTGATTTGG - Intergenic
1169178884 20:3544213-3544235 GCTCAACAGGCATTCTGATAAGG - Intronic
1169898405 20:10528752-10528774 ACTGGCCAGCCACTCTGGTTGGG - Intronic
1170863493 20:20130790-20130812 GCTGAACTGCCATGCTAATTTGG + Intronic
1173482027 20:43409308-43409330 GATGAACAGCCACTCTGATTTGG - Intergenic
1177104843 21:16943046-16943068 GCTGAACAGCCATTCTGATTTGG + Intergenic
1179771326 21:43619843-43619865 GCTGAACAGCCGCTCTGATTTGG - Intronic
1180575984 22:16774932-16774954 GCTGCACAGGCACTCTGGTTTGG + Intergenic
1184327469 22:43800108-43800130 GCTGAAAATACACTCTGATTTGG - Intronic
1184576093 22:45367507-45367529 GCTGAACAGCCACTCTAATTTGG + Intronic
1185152146 22:49170003-49170025 ACTGACCAGCCACTGAGATTGGG - Intergenic
949250039 3:1972852-1972874 GCTGAATAGTCACTGTGATGTGG - Intergenic
949818186 3:8084883-8084905 ACTGAACAACCACTCTAATTTGG + Intergenic
951655510 3:25003270-25003292 GCAGAACAGCCATGCTGTTTAGG + Intergenic
951797246 3:26553195-26553217 GCTAAATAGCCACTCAGATTTGG - Intergenic
952563182 3:34620328-34620350 GCTGAACAGCCACTCTGACTGGG + Intergenic
952832735 3:37578630-37578652 CCTGGACCACCACTCTGATTTGG + Intronic
953682937 3:45052973-45052995 TCTGGACAGCCACCCTGAGTTGG - Intergenic
953711702 3:45276735-45276757 GCTGAACAGTCAGTCTGATTTGG - Intergenic
955160626 3:56462308-56462330 GGTTAACAGCAACTATGATTTGG + Intronic
955267831 3:57464282-57464304 GCAGAATAGCCACTCTGATTTGG - Intronic
956023759 3:64960112-64960134 ACTCAGCAGTCACTCTGATTTGG + Intergenic
956399876 3:68866176-68866198 GCTGAACAACCACTCTAGTTTGG - Intronic
957655640 3:83070521-83070543 GGTAAACAGCTACTCTGATTTGG - Intergenic
957777480 3:84772530-84772552 ACTAAACAGGCCCTCTGATTTGG - Intergenic
958825626 3:99026809-99026831 GCTGAACAGCCAGTCTGATTTGG - Intergenic
959636753 3:108582988-108583010 TCGGAGCAGCCACACTGATTCGG - Exonic
962613262 3:137099193-137099215 GCTGGACAGAAACTTTGATTAGG + Intergenic
962823031 3:139071257-139071279 GCTGAGCAATCACTCTGATTTGG + Intronic
963404117 3:144840675-144840697 GCTGAAGAGCCACTCTGATTTGG + Intergenic
963819268 3:149870012-149870034 ACTGAATAGCTACTGTGATTTGG + Intronic
964537123 3:157735159-157735181 GCTGAACACACACTCTGATTTGG - Intergenic
965094677 3:164209720-164209742 GATAAATAGCCACTCAGATTTGG - Intergenic
965867387 3:173221359-173221381 GCTGAACAGCCTTTCTGTTTTGG + Intergenic
966127782 3:176600073-176600095 GCTGAACAGCATCTCTGATTTGG - Intergenic
968719084 4:2186364-2186386 ACTGACCAGCCTTTCTGATTTGG - Intronic
969473824 4:7409415-7409437 GCTGAACAGACACTCTGATTTGG + Intronic
971544016 4:27861630-27861652 ACTGAACAGCTGTTCTGATTTGG + Intergenic
971569146 4:28187663-28187685 GCTGAACGACCACACTGATTTGG + Intergenic
971797345 4:31244680-31244702 GCTGAATAACAACTTTGATTTGG - Intergenic
973950427 4:56007465-56007487 ACTGAACTACCACTCTGATTGGG + Intronic
975345379 4:73287111-73287133 GCTAAACAGCCACTTTGATTTGG - Intergenic
975418912 4:74139330-74139352 GATGAATAGCTACTCTGATTTGG + Intronic
975419603 4:74147443-74147465 GCTGAACAGCCACTCTAATTTGG + Intronic
976149136 4:82075730-82075752 GCTGAGCAGACAGTGTGATTGGG - Intergenic
976833891 4:89348189-89348211 GCTGAACAGTCACTCTAATTTGG + Intergenic
977872232 4:102105838-102105860 TCTCAACAGCCACTCTGATTTGG - Intergenic
979649739 4:123115297-123115319 GCTGAACAGTCACTCCGACGTGG + Intronic
980066211 4:128191644-128191666 GCTGAACAGCCACTCTGATATGG + Intronic
980620372 4:135293899-135293921 GCTGAACAACCACTCTGATTTGG + Intergenic
980868044 4:138576742-138576764 GCTGAATAACCACTCTGATTTGG - Intergenic
981459065 4:144990988-144991010 GCTGAACAGCCACTCTGATGTGG - Intronic
981886333 4:149677302-149677324 GCTTAAAAGCCACTCTTATTTGG - Intergenic
981900691 4:149858362-149858384 GCTGAATAGCCACTTTAATTTGG - Intergenic
982280182 4:153676335-153676357 GCTAAACAGTCACTCTGATTTGG + Intergenic
982501318 4:156159783-156159805 GCTGAACAGCCACTCTCATTTGG - Intergenic
982910641 4:161137612-161137634 GCCAAACAGCCACTCTGATTTGG - Intergenic
983655621 4:170080571-170080593 GCTGAACAGTCACTCTGTTTTGG - Intronic
985351105 4:189062209-189062231 GGTGAGCAGCTGCTCTGATTTGG - Intergenic
985700806 5:1371243-1371265 GCTGAACACCCCCTCAGAATTGG - Intergenic
986656851 5:10021285-10021307 GCTCAACAGCCATTCTGATTTGG - Intergenic
987189697 5:15463506-15463528 GCTCATCAGCCACTCTGATTTGG + Intergenic
989390340 5:40894082-40894104 GCTGAATACCCACTCTAATTTGG + Intergenic
989648174 5:43659227-43659249 GCTGAACAGCTACTCAGGCTGGG + Exonic
989663141 5:43821438-43821460 GCTAAACAGCCACTCTGATTTGG - Intergenic
991141103 5:63244001-63244023 GCACAACAGCCACTCCAATTAGG - Intergenic
991237451 5:64416247-64416269 ACTGAACAGTCACTCTGATCTGG - Intergenic
992313006 5:75521978-75522000 GCCGAACAAGTACTCTGATTTGG + Intronic
992654977 5:78900218-78900240 GCTGAATAGCCACTCTGATTTGG + Intronic
992658879 5:78938219-78938241 ACTGAACAGCCATGCTGATTTGG - Intronic
993034719 5:82744469-82744491 GCTGAACAGCTAATGTAATTTGG - Intergenic
993054614 5:82968009-82968031 GCAGGACAGCCACTCCCATTTGG - Intergenic
994134251 5:96266494-96266516 GCTGAACAGTCACTCTGATTTGG - Intergenic
994283079 5:97929716-97929738 GGTAAACAGACACTCTTATTAGG - Intergenic
994317560 5:98349708-98349730 GCTAAGCAGCCACTCCGATTTGG - Intergenic
994597169 5:101854189-101854211 GCTGAACAGCCAGTATGATTTGG - Intergenic
994653679 5:102562160-102562182 GCTAAAAAGTCACTCTGATTTGG - Intergenic
995164042 5:109016378-109016400 GTGTATCAGCCACTCTGATTTGG + Intronic
995278791 5:110308845-110308867 GCTAAACAGCCACTCTGATTTGG - Intronic
996067158 5:119091821-119091843 ACTGAACAGCCTCTCTCATGTGG + Intronic
997711403 5:136007750-136007772 GCTGAGCATCCACTCTGCTTAGG - Intergenic
999081763 5:148851014-148851036 ACTAAACAGCCACTCTGGCTGGG + Intergenic
999256784 5:150213932-150213954 GCTGCTCAGCCACACTGATCTGG + Intronic
999660380 5:153856445-153856467 GCTGAACAGCCACTCTGATTCGG + Intergenic
999710497 5:154314275-154314297 GCTGAAGAGACACTCAGATCTGG - Intronic
999969764 5:156847596-156847618 GCTGAATAGCTACCCTGATTTGG - Intergenic
1000840929 5:166217308-166217330 GCTGAAGAGCCAGTGTGTTTTGG + Intergenic
1001648007 5:173296727-173296749 GCTGCACTGCCACTCTGATGAGG + Intergenic
1002129092 5:177068642-177068664 GGGGAAAAGGCACTCTGATTTGG + Intronic
1002988160 6:2211328-2211350 GCTGAACACCCACTATGTTCAGG - Intronic
1003079621 6:3010728-3010750 GCTGAACAGCCACTCTGGTTTGG - Intronic
1003237776 6:4313285-4313307 GCTGCACAGCCACACTAATTTGG + Intergenic
1003429269 6:6024053-6024075 GCTGAACAGCAACACTGTATTGG - Intergenic
1003590866 6:7435565-7435587 GCTAAATAGTCACTCTGACTTGG - Intergenic
1003657762 6:8029614-8029636 GCTGAGTAGCCACTTTGATTTGG - Intronic
1003775339 6:9354382-9354404 GCTGAAAAGCCACTCTGATTTGG - Intergenic
1004645270 6:17554389-17554411 GCTGAAGAGCCACTCTGATTTGG - Intronic
1005767053 6:29022260-29022282 GCTGACCAGCTTCGCTGATTTGG + Intergenic
1007040803 6:38720341-38720363 GCCAAACAGCAACTCTGATTTGG - Intronic
1007165354 6:39825044-39825066 GCTAAGCAGCCTCTCTGATCAGG - Intronic
1007897311 6:45376493-45376515 GCTGAAGAGCCACTGTGCCTAGG + Intronic
1008939035 6:57025599-57025621 GCTGAACAGGCACTCTGATTTGG + Intronic
1009791627 6:68408715-68408737 GGTGGAGAGCAACTCTGATTGGG + Intergenic
1009874924 6:69493862-69493884 GCTCAACAGCCACTCTGATTTGG - Intergenic
1010353120 6:74899699-74899721 GCTGAACAGTCACTCTGATTTGG + Intergenic
1010539680 6:77075959-77075981 TCTGAACAGCCACTCTGATTTGG - Intergenic
1011615491 6:89194178-89194200 ACTGAACAGCCACTCTGATTTGG - Intronic
1011756870 6:90508958-90508980 GCCGAAAAGCCACTCTGATTTGG + Intergenic
1012818145 6:104050726-104050748 TCTGCACATGCACTCTGATTTGG - Intergenic
1013372135 6:109480272-109480294 GCTTAAAACCCACTCTGCTTTGG - Intronic
1013571209 6:111427896-111427918 GCTGAACAGCCACTCCAACTTGG - Intronic
1014130788 6:117829846-117829868 GCTGAAGAGCCACTCTTATTTGG - Intergenic
1014957751 6:127642010-127642032 GCTGAACAGCTACTCTGATTTGG - Intergenic
1015216855 6:130760060-130760082 GCTGAATAGCCACTCTGATTTGG - Intergenic
1016155378 6:140800344-140800366 GCTGAACAGCCACTCTGATTTGG + Intergenic
1016263770 6:142207429-142207451 GCTGAACAGCCATTCTGATTTGG - Intronic
1016615357 6:146041638-146041660 GCTGAACCTCCTCTCTGACTCGG + Intronic
1017502202 6:155036117-155036139 GCTGGATGGCCACTCTGTTTGGG - Intronic
1017551212 6:155510035-155510057 GGTGAACAGCCAGTCTTATTAGG + Intergenic
1017934133 6:158989550-158989572 GCTGAACAGCCACTCTGATTTGG + Intronic
1017999961 6:159570181-159570203 GCTGAACATCCACTCCCATCTGG + Intergenic
1019089948 6:169520142-169520164 GCTGAGCAGCCACTCCGATTTGG - Intronic
1019131340 6:169879133-169879155 GCTGAACAGCCACTCTCGTTTGG + Intergenic
1020632132 7:10652084-10652106 GCTGACCTACCACTCTGTTTAGG - Intergenic
1021241918 7:18212817-18212839 AATGAACAACCACTTTGATTAGG - Intronic
1021544164 7:21794637-21794659 GTTGAACAGCCACTCTGATTTGG + Intronic
1021771831 7:24010827-24010849 GCTGAACAGCCACTTTGATTTGG + Intergenic
1022966422 7:35477668-35477690 GTTGAATAGCTACTCTGTTTTGG - Intergenic
1023074101 7:36466184-36466206 GCTGAACAGAGACTCTTATCAGG + Intergenic
1024412431 7:49060583-49060605 GCTGAATAGCCACTCCGATTTGG + Intergenic
1025040638 7:55641541-55641563 ACTGAACAGCCACTGTGATTTGG + Intergenic
1027393476 7:77728550-77728572 GCTCAACAGCCACCCTGATTTGG + Intronic
1028152158 7:87386752-87386774 GCTGAACAACCTCTTTGATTTGG + Intronic
1028192338 7:87867971-87867993 GCTGAACAGCCACTATGATTTGG + Intronic
1028543517 7:91972195-91972217 GCTGAACAGCCAGTCTGATTTGG + Intronic
1028560360 7:92168444-92168466 GCTGAATAGGCACTCTGATGTGG - Intronic
1029586923 7:101479563-101479585 TCTGCAGAGCCACTATGATTTGG + Intronic
1030488028 7:110195671-110195693 GCTGCACAGGCACTGTGAGTTGG - Intergenic
1031482129 7:122290831-122290853 GCTGAACAGCCACTCCAATTTGG + Intergenic
1031569429 7:123340925-123340947 GCTGAACAGCTACTCTGATTTGG + Intergenic
1033374462 7:140744089-140744111 GATAAACAGACACTCTGATCAGG - Intronic
1033613926 7:142992971-142992993 GCTGAACAACCACTCTGATTTGG - Intergenic
1037034981 8:14155025-14155047 GATTTACAGCCACTCTGTTTTGG + Intronic
1037282774 8:17261830-17261852 GCTGAATAGGCACTCTGATTTGG + Intronic
1039032467 8:33325299-33325321 GGTGGACTGCCACTCTGATGGGG - Intergenic
1039138976 8:34361229-34361251 GCTGAAGAGCTATTCTGATATGG + Intergenic
1041609691 8:59830879-59830901 GCTGAACAGCCACTCTGATTTGG - Intergenic
1044144610 8:88696315-88696337 GCCGAACAACTACTGTGATTTGG + Intergenic
1044407583 8:91846548-91846570 GCTGAATAGCCACTCTGATTTGG - Intergenic
1045606308 8:103781116-103781138 GTGGAATAGCCCCTCTGATTTGG + Intronic
1046415976 8:113914592-113914614 ACTGAGCAGCCACTCTGATTTGG - Intergenic
1046814260 8:118566707-118566729 GATGAACAGTCTCTCTGGTTTGG - Intronic
1048080115 8:131117780-131117802 GCTCAACAGCCACTCTGATTTGG + Intergenic
1049953591 9:670613-670635 GCCGAACACCCACTCTGATTTGG + Intronic
1050478721 9:6067664-6067686 GCTGACCAGCCATTCTGTGTGGG + Intergenic
1050564336 9:6866482-6866504 GCTGAGCTGCCACTCTGATTTGG + Intronic
1050841820 9:10158963-10158985 GCTGAACAGCCACTCTGACTTGG - Intronic
1052689543 9:31800021-31800043 GCTGAACAGCTACTCTGATTTGG - Intergenic
1052734670 9:32328796-32328818 GCTGAACAGCCAGTCTGATTTGG - Intergenic
1055202575 9:73684621-73684643 AGTGAACAGCCACTCTTATTTGG + Intergenic
1057296304 9:93845039-93845061 GGTGAACAGCCACTGTGATTTGG + Intergenic
1058316491 9:103573610-103573632 GCAAATCAGCCACTCTGATTTGG - Intergenic
1059684713 9:116623866-116623888 CCTGTTCAGCCACTCTGCTTGGG + Intronic
1060166953 9:121425299-121425321 GCTGAACAGCAACTCTGATTTGG - Intergenic
1187714227 X:22086228-22086250 GCTGAACAGCCACTCTGATTTGG + Intronic
1187941408 X:24386347-24386369 GCTGAACGGCTACTCTGATTTGG + Intergenic
1188479023 X:30618396-30618418 GCTGAGCAGCCACTCTGATTTGG - Intergenic
1188479025 X:30618428-30618450 GCTGAGCAGCCACTCTGATTTGG - Intergenic
1188903136 X:35759755-35759777 ACTGAACAGTCACTCTGATTTGG + Intergenic
1189706241 X:43761622-43761644 GCACAGCAGCCACTCAGATTTGG + Intergenic
1191664614 X:63687126-63687148 GTTAAACAGCCTTTCTGATTTGG - Intronic
1192504607 X:71673565-71673587 GCTAAACGGCCACTCTGATTTGG - Intergenic
1192521932 X:71809839-71809861 GCTGAACAGCCACTCTGATTTGG + Intergenic
1192752913 X:74013057-74013079 GCTGAACAGCCACTCTGACTTGG - Intergenic
1192936784 X:75868914-75868936 GCTAAATAGCCACTCTGATTTGG + Intergenic
1193232883 X:79069049-79069071 GCTAAACAGACACTCTGATTTGG + Intergenic
1195073569 X:101304652-101304674 GCTGAACTGCCTCTCTGATTTGG + Intergenic
1195736895 X:108020897-108020919 GCTGAACAGCTAATCTGTTTTGG + Intergenic
1196882778 X:120213702-120213724 GCTAAACCACCTCTCTGATTTGG - Intergenic
1196987108 X:121286384-121286406 GCCGAACAGTCGCTCTTATTTGG + Intergenic
1197260611 X:124313193-124313215 GCTGAACAGCTACTCTGATTTGG - Intronic
1199133285 X:144220068-144220090 GCTGGGCAGTCACTCTGATTTGG + Intergenic
1199245044 X:145593937-145593959 GCTGAACAGCCACTTTGATTTGG - Intergenic
1200295747 X:154918279-154918301 GCTGAACATTCTCTCTCATTTGG + Intronic
1200416085 Y:2911533-2911555 CCTGACAAGCCACTCTGATTTGG - Intronic
1201236601 Y:11917891-11917913 GGTGAAAAGCCACTCTGAGGAGG + Intergenic
1201347791 Y:13004184-13004206 GATGAACACACTCTCTGATTTGG + Intergenic
1201504183 Y:14679660-14679682 GCAGAACAGCCACCCTGTTTAGG + Intronic
1202343897 Y:23900826-23900848 GCTGCACAGGCACTCGGGTTTGG + Intergenic
1202526871 Y:25769258-25769280 GCTGCACAGGCACTCGGGTTTGG - Intergenic