ID: 941360610

View in Genome Browser
Species Human (GRCh38)
Location 2:164546856-164546878
Sequence GTTCAGCAGCACCACACGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941360607_941360610 5 Left 941360607 2:164546828-164546850 CCAAAGGAGACACCAAATCAGAG 0: 11
1: 26
2: 68
3: 88
4: 243
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data
941360606_941360610 9 Left 941360606 2:164546824-164546846 CCAGCCAAAGGAGACACCAAATC No data
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data
941360609_941360610 -7 Left 941360609 2:164546840-164546862 CCAAATCAGAGTGGCTGTTCAGC 0: 21
1: 71
2: 56
3: 63
4: 141
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data
941360603_941360610 30 Left 941360603 2:164546803-164546825 CCAGAAACTCTGCTCTGCAACCC No data
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data
941360605_941360610 10 Left 941360605 2:164546823-164546845 CCCAGCCAAAGGAGACACCAAAT No data
Right 941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941360610 Original CRISPR GTTCAGCAGCACCACACGAT AGG Intronic
No off target data available for this crispr