ID: 941360618

View in Genome Browser
Species Human (GRCh38)
Location 2:164546888-164546910
Sequence ACCCATGGCCAGGGGACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941360618_941360625 4 Left 941360618 2:164546888-164546910 CCACAGGTCCCCTGGCCATGGGT No data
Right 941360625 2:164546915-164546937 AGCCAGCTGTCCCAAACTGTTGG No data
941360618_941360630 18 Left 941360618 2:164546888-164546910 CCACAGGTCCCCTGGCCATGGGT No data
Right 941360630 2:164546929-164546951 AACTGTTGGGATATCCCCTTTGG No data
941360618_941360631 19 Left 941360618 2:164546888-164546910 CCACAGGTCCCCTGGCCATGGGT No data
Right 941360631 2:164546930-164546952 ACTGTTGGGATATCCCCTTTGGG 0: 2
1: 0
2: 5
3: 38
4: 135
941360618_941360626 5 Left 941360618 2:164546888-164546910 CCACAGGTCCCCTGGCCATGGGT No data
Right 941360626 2:164546916-164546938 GCCAGCTGTCCCAAACTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941360618 Original CRISPR ACCCATGGCCAGGGGACCTG TGG (reversed) Intronic
No off target data available for this crispr