ID: 941366904

View in Genome Browser
Species Human (GRCh38)
Location 2:164621178-164621200
Sequence ACGACCTGGCGCCGGCCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941366904_941366910 -2 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366910 2:164621199-164621221 GTGGGCGTCGCCCCTCCCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 142
941366904_941366921 26 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366904_941366909 -3 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366909 2:164621198-164621220 CGTGGGCGTCGCCCCTCCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 119
941366904_941366919 19 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366919 2:164621220-164621242 GGCAGCGCCACACACCTGGGCGG 0: 1
1: 0
2: 10
3: 20
4: 205
941366904_941366917 15 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366917 2:164621216-164621238 CCTGGGCAGCGCCACACACCTGG 0: 1
1: 0
2: 0
3: 23
4: 233
941366904_941366918 16 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366918 2:164621217-164621239 CTGGGCAGCGCCACACACCTGGG 0: 1
1: 0
2: 1
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941366904 Original CRISPR ACGACCTGGCGCCGGCCCCC TGG (reversed) Exonic