ID: 941366907

View in Genome Browser
Species Human (GRCh38)
Location 2:164621186-164621208
Sequence CGACGCCCACGACCTGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941366907_941366918 8 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366918 2:164621217-164621239 CTGGGCAGCGCCACACACCTGGG 0: 1
1: 0
2: 1
3: 15
4: 176
941366907_941366917 7 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366917 2:164621216-164621238 CCTGGGCAGCGCCACACACCTGG 0: 1
1: 0
2: 0
3: 23
4: 233
941366907_941366921 18 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366907_941366910 -10 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366910 2:164621199-164621221 GTGGGCGTCGCCCCTCCCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 142
941366907_941366924 29 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366907_941366919 11 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366919 2:164621220-164621242 GGCAGCGCCACACACCTGGGCGG 0: 1
1: 0
2: 10
3: 20
4: 205
941366907_941366923 28 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366923 2:164621237-164621259 GGGCGGCCAGCGGCGAATCCCGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941366907 Original CRISPR CGACGCCCACGACCTGGCGC CGG (reversed) Exonic