ID: 941366908

View in Genome Browser
Species Human (GRCh38)
Location 2:164621192-164621214
Sequence GAGGGGCGACGCCCACGACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941366908_941366919 5 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366919 2:164621220-164621242 GGCAGCGCCACACACCTGGGCGG 0: 1
1: 0
2: 10
3: 20
4: 205
941366908_941366924 23 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366908_941366923 22 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366923 2:164621237-164621259 GGGCGGCCAGCGGCGAATCCCGG 0: 1
1: 0
2: 0
3: 5
4: 62
941366908_941366921 12 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366908_941366917 1 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366917 2:164621216-164621238 CCTGGGCAGCGCCACACACCTGG 0: 1
1: 0
2: 0
3: 23
4: 233
941366908_941366918 2 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366918 2:164621217-164621239 CTGGGCAGCGCCACACACCTGGG 0: 1
1: 0
2: 1
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941366908 Original CRISPR GAGGGGCGACGCCCACGACC TGG (reversed) Exonic