ID: 941366908

View in Genome Browser
Species Human (GRCh38)
Location 2:164621192-164621214
Sequence GAGGGGCGACGCCCACGACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941366908_941366924 23 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366908_941366917 1 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366917 2:164621216-164621238 CCTGGGCAGCGCCACACACCTGG 0: 1
1: 0
2: 0
3: 23
4: 233
941366908_941366921 12 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366908_941366919 5 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366919 2:164621220-164621242 GGCAGCGCCACACACCTGGGCGG 0: 1
1: 0
2: 10
3: 20
4: 205
941366908_941366918 2 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366918 2:164621217-164621239 CTGGGCAGCGCCACACACCTGGG 0: 1
1: 0
2: 1
3: 15
4: 176
941366908_941366923 22 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366923 2:164621237-164621259 GGGCGGCCAGCGGCGAATCCCGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941366908 Original CRISPR GAGGGGCGACGCCCACGACC TGG (reversed) Exonic
900168369 1:1254163-1254185 GAGGGGAGACGGCCGAGACCCGG + Intronic
900954241 1:5876872-5876894 CAGGGGTGACGCCCAAGAACTGG + Intronic
920166681 1:204041222-204041244 GAAGGGCGAGGCCCACCCCCTGG + Intergenic
922808309 1:228401858-228401880 GGGAGCCCACGCCCACGACCTGG + Intronic
923008087 1:230067633-230067655 GAGGGGCGACGTCCACGAGAGGG - Intronic
1069757693 10:70783140-70783162 GAGGGGCAAAGCCCACTACCTGG + Intronic
1072465276 10:95656899-95656921 CAGGGGGAACGCCCACGTCCCGG + Intergenic
1073318468 10:102599518-102599540 GAATGGCCTCGCCCACGACCGGG + Exonic
1079137679 11:17785143-17785165 CAGGGGCCAGGCCAACGACCAGG + Intergenic
1086130243 11:83393942-83393964 GTGGGGAGAGGCCCACAACCAGG - Intergenic
1114660338 14:24339604-24339626 GAGGGGTGTCGCCCACTAGCCGG + Intronic
1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG + Exonic
1122959578 14:105088283-105088305 GAGGGGCGGCTCCCAGGGCCTGG - Intergenic
1130076540 15:80695116-80695138 GGGGGGCGGCGCGCACGAGCCGG + Intronic
1143904569 17:10198597-10198619 GAGCGGCGACGCCCCCGGGCCGG + Intergenic
1145031293 17:19507277-19507299 GGAGGGCGACGCCCACGGCCAGG - Intronic
1148751076 17:49946268-49946290 GAGGGGAGATGCCCTCCACCAGG - Intergenic
1152938060 17:83152169-83152191 GCGGGGGGACACCCAGGACCAGG - Intergenic
1160994351 19:1875808-1875830 GAGGGGCACGGCGCACGACCGGG + Intergenic
1166313644 19:41976647-41976669 GAGGGGCCAGCCCCACAACCAGG + Intronic
929604562 2:43226179-43226201 GAGGGGCGTCCCCCAGAACCTGG + Intronic
932761305 2:74440633-74440655 AAGGGGCGAGGCCCGGGACCAGG - Intronic
941366908 2:164621192-164621214 GAGGGGCGACGCCCACGACCTGG - Exonic
948355617 2:237374764-237374786 GAGGGCCGACCCCCAACACCGGG - Exonic
1171032924 20:21693105-21693127 GAGGGGAGAGGCCCAAGTCCTGG - Intergenic
950631053 3:14282222-14282244 GAGGGGCCACTCCCATGAGCTGG - Intergenic
954842733 3:53526201-53526223 GAGGGGTGACGCACATGACCTGG - Intronic
961609205 3:128123410-128123432 GAGGGGCGCCGCCCTGGAGCTGG - Intronic
968008730 3:195259780-195259802 GAGGGGCCACCCCCACCACGCGG + Intronic
968190041 3:196660879-196660901 CAGGGGGGACGCCCAGGAGCTGG - Exonic
968752444 4:2397020-2397042 CAGGGGCGACTGCCACGGCCGGG + Intronic
972750404 4:41982346-41982368 GAGGGACCACGCACAGGACCAGG - Exonic
975689399 4:76949573-76949595 GAGGGGCGAGCCCCGCGGCCGGG + Intergenic
984966338 4:185143408-185143430 CAGCGGCGACGCCCCCGGCCAGG - Exonic
985721824 5:1493516-1493538 GAGGGGCGTCGCCTATGGCCGGG - Intronic
1018897055 6:168027094-168027116 GATGGGGGAGGCCCTCGACCTGG + Intronic
1022088003 7:27087830-27087852 GAGGGGCGAGGCCTCTGACCTGG + Intergenic
1033306736 7:140230813-140230835 GGGCGGCGACCCCCACGGCCCGG - Intergenic
1034974421 7:155439545-155439567 GAGGGGCGGTGCCCAGGACTTGG + Intergenic
1037903836 8:22703782-22703804 GAGCGGCGCCGCCCGCGGCCCGG - Intergenic
1038147805 8:24914228-24914250 GCTGGGCGACGCGTACGACCAGG + Exonic
1039887570 8:41663907-41663929 CAGGGGCGCCGCCCACGCCCTGG - Intronic
1051641791 9:19230639-19230661 GAGGGGCGCCGCCTACAGCCAGG - Exonic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1190952633 X:55161544-55161566 GAGAGGCGCCGGCCACGGCCTGG - Intronic
1192320306 X:70085445-70085467 AAAGGGCGCCGCCCACCACCAGG + Intergenic