ID: 941366917

View in Genome Browser
Species Human (GRCh38)
Location 2:164621216-164621238
Sequence CCTGGGCAGCGCCACACACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941366907_941366917 7 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366917 2:164621216-164621238 CCTGGGCAGCGCCACACACCTGG 0: 1
1: 0
2: 0
3: 23
4: 233
941366908_941366917 1 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366917 2:164621216-164621238 CCTGGGCAGCGCCACACACCTGG 0: 1
1: 0
2: 0
3: 23
4: 233
941366904_941366917 15 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366917 2:164621216-164621238 CCTGGGCAGCGCCACACACCTGG 0: 1
1: 0
2: 0
3: 23
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941366917 Original CRISPR CCTGGGCAGCGCCACACACC TGG Exonic