ID: 941366918

View in Genome Browser
Species Human (GRCh38)
Location 2:164621217-164621239
Sequence CTGGGCAGCGCCACACACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941366904_941366918 16 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366918 2:164621217-164621239 CTGGGCAGCGCCACACACCTGGG 0: 1
1: 0
2: 1
3: 15
4: 176
941366907_941366918 8 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366918 2:164621217-164621239 CTGGGCAGCGCCACACACCTGGG 0: 1
1: 0
2: 1
3: 15
4: 176
941366908_941366918 2 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366918 2:164621217-164621239 CTGGGCAGCGCCACACACCTGGG 0: 1
1: 0
2: 1
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941366918 Original CRISPR CTGGGCAGCGCCACACACCT GGG Exonic