ID: 941366919

View in Genome Browser
Species Human (GRCh38)
Location 2:164621220-164621242
Sequence GGCAGCGCCACACACCTGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 10, 3: 20, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941366908_941366919 5 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366919 2:164621220-164621242 GGCAGCGCCACACACCTGGGCGG 0: 1
1: 0
2: 10
3: 20
4: 205
941366907_941366919 11 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366919 2:164621220-164621242 GGCAGCGCCACACACCTGGGCGG 0: 1
1: 0
2: 10
3: 20
4: 205
941366904_941366919 19 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366919 2:164621220-164621242 GGCAGCGCCACACACCTGGGCGG 0: 1
1: 0
2: 10
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941366919 Original CRISPR GGCAGCGCCACACACCTGGG CGG Exonic