ID: 941366919 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:164621220-164621242 |
Sequence | GGCAGCGCCACACACCTGGG CGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 236 | |||
Summary | {0: 1, 1: 0, 2: 10, 3: 20, 4: 205} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
941366908_941366919 | 5 | Left | 941366908 | 2:164621192-164621214 | CCAGGTCGTGGGCGTCGCCCCTC | 0: 1 1: 0 2: 0 3: 5 4: 40 |
||
Right | 941366919 | 2:164621220-164621242 | GGCAGCGCCACACACCTGGGCGG | 0: 1 1: 0 2: 10 3: 20 4: 205 |
||||
941366907_941366919 | 11 | Left | 941366907 | 2:164621186-164621208 | CCGGCGCCAGGTCGTGGGCGTCG | 0: 1 1: 0 2: 0 3: 2 4: 48 |
||
Right | 941366919 | 2:164621220-164621242 | GGCAGCGCCACACACCTGGGCGG | 0: 1 1: 0 2: 10 3: 20 4: 205 |
||||
941366904_941366919 | 19 | Left | 941366904 | 2:164621178-164621200 | CCAGGGGGCCGGCGCCAGGTCGT | 0: 1 1: 0 2: 0 3: 8 4: 67 |
||
Right | 941366919 | 2:164621220-164621242 | GGCAGCGCCACACACCTGGGCGG | 0: 1 1: 0 2: 10 3: 20 4: 205 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
941366919 | Original CRISPR | GGCAGCGCCACACACCTGGG CGG | Exonic | ||